Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs2254298 [Homo sapiens]
    TCAGAGGAAGAAGCCCCGCAAACTG[A/G]GAAAACAGGGATGGTTTCCTGAAAG
    Chromosome:
    3:8760542
    Gene:
    OXTR (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.2071/1037
    HGVS:
    CM000665.2:g.8760542G>A, NC_000003.11:g.8802228G>A, NC_000003.12:g.8760542G>A, NG_008797.2:g.31733G>A, NM_000916.3:c.922+6724C>T, NM_001354653.1:c.922+6724C>T, NM_001354654.1:c.922+6724C>T, NM_001354655.1:c.922+6724C>T, NM_001354656.1:c.922+6724C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center