Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 6

1.

rs10784502 [Homo sapiens]
    AACTTCACATCCACTTGGATGTCTA[C/T]AAGCAAAAAGACAGGCAATAACAAG
    Chromosome:
    12:65950030
    Gene:
    HMGA2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3411/1708
    HGVS:
    NC_000012.11:g.66343810C>T, NC_000012.12:g.65950030C>T, NG_016296.1:g.130571C>T, NM_001300918.1:c.250-1353C>T, NM_003483.4:c.250-1353C>T, XM_005269164.1:c.250-1353C>T
    2.

    rs10494373 [Homo sapiens]
      TCTGTCTTCATATTCAAAAAGGAAA[A/C]TAATCTGCAATTTCTCTACTCTGCA
      Chromosome:
      1:162649572
      Gene:
      DDR2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0505/253
      HGVS:
      NC_000001.10:g.162619362A>C, NC_000001.11:g.162649572A>C, NG_016290.1:g.22135A>C, NM_001014796.1:c.-271-5639A>C, NM_006182.2:c.-191-5639A>C, XM_006711344.3:c.-191-5639A>C, XM_011509586.2:c.-191-5639A>C, XM_011509587.2:c.-271-5639A>C, XM_011509588.2:c.-191-5639A>C
      3.

      rs7315280 [Homo sapiens]
        CACCTCCTTAATCCCCCTAGTCTTT[A/G]CAGAGGGGACCTGATCCATTGCCCG
        Chromosome:
        12:116883133
        Gene:
        HRK (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1853/928
        HGVS:
        NC_000012.11:g.117320938A>G, NC_000012.12:g.116883133A>G, NM_003806.2:c.-1826T>C, NR_073189.1:n.-1706T>C, XM_017020146.1:c.-1826T>C
        4.

        rs7294919 [Homo sapiens]
          CCCCAGAtatattagctagtatgca[C/T]tgggcaaaagtaacaggaaattcaa
          Chromosome:
          12:116889787
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2119/1061
          HGVS:
          NC_000012.11:g.117327592T>C, NC_000012.12:g.116889787T>C
          6.

          rs8756 [Homo sapiens]
            TCTTTGCTGTTGTTGGTCGCAGCTA[A/C]ATAAGACTGGACATTTAACTTTTCT
            Chromosome:
            12:65965972
            Gene:
            HMGA2 (GeneView)
            Functional Consequence:
            utr variant 3 prime
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.3081/1543
            HGVS:
            NC_000012.11:g.66359752C>A, NC_000012.12:g.65965972C>A, NG_016296.1:g.146513C>A, NM_003483.4:c.*2680C>A

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center