Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs9939609 [Homo sapiens]
    GGTTCCTTGCGACTGCTGTGAATTT[A/T]GTGATGCACTTGGATAGTCTCTGTT
    Chromosome:
    16:53786615
    Gene:
    FTO (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    A=0.3401/1703
    HGVS:
    CM000678.2:g.53786615T>A, NC_000016.10:g.53786615T>A, NC_000016.9:g.53820527T>A, NG_012969.1:g.87653T>A, NM_001080432.2:c.46-23525T>A, XR_001751980.1:n.232-23525T>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center