Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs3813034 [Homo sapiens]
    ACAATTGAGTTGGTAGAATTTGTTA[A/C]TGTAAGAAAAATTTGGGGAATTCAT
    Chromosome:
    17:30197786
    Gene:
    SLC6A4 (GeneView)
    Functional Consequence:
    utr variant 3 prime
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.4834/2421
    HGVS:
    NC_000017.10:g.28524804A>C, NC_000017.11:g.30197786A>C, NG_011747.2:g.43151T>G, NM_001045.5:c.*670T>G, XM_005258025.1:c.*670T>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center