Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 6

1.

rs367543064 [Homo sapiens]
    GCCAGAGAGCCTCGCAAGAACAGCC[-/C]ACACTGCCATGAAGGAACTATCCCA
    Chromosome:
    5:37170096
    Gene:
    C5orf42 (GeneView)
    Functional Consequence:
    frameshift variant,nc transcript variant
    Allele Origin:
    C(germline)/+.-----(germline)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000005.10:g.37170096delG, NC_000005.9:g.37170198delG, NG_032772.1:g.84333delC, NM_023073.3:c.6407delC, NP_075561.3:p.Pro2136Hisfs, XM_005248345.1:c.6407delC, XM_005248345.3:c.6407delC, XM_005248346.1:c.6404delC, XM_005248346.3:c.6404delC, XM_005248347.1:c.6404delC, XM_005248347.3:c.6404delC, XM_005248348.1:c.6407delC, XM_005248349.1:c.6404delC, XM_005248349.3:c.6404delC, XM_005248350.1:c.6278delC, XM_005248350.3:c.6278delC, XM_005248351.1:c.6407delC, XM_005248352.1:c.6407delC, XM_005248353.1:c.3050delC, XM_006714491.3:c.980delC, XM_011514085.2:c.6407delC, XM_011514086.2:c.6407delC, XM_011514087.2:c.6407delC, XM_011514088.2:c.6407delC, XM_011514089.2:c.6407delC, XM_011514090.2:c.6089delC, XM_011514092.2:c.6407delC, XM_011514094.2:c.3632delC, XM_017009760.1:c.6218delC, XM_017009761.1:c.6218delC, XM_017009762.1:c.5735delC, XM_017009763.1:c.5414delC, XM_017009764.1:c.5414delC, XM_017009765.1:c.5219delC, XM_017009766.1:c.3050delC, XP_005248402.1:p.Pro2136Hisfs, XP_005248403.1:p.Pro2135Hisfs, XP_005248404.1:p.Pro2135Hisfs, XP_005248405.1:p.Pro2136Hisfs, XP_005248406.1:p.Pro2135Hisfs, XP_005248407.1:p.Pro2093Hisfs, XP_005248408.1:p.Pro2136Hisfs, XP_005248409.1:p.Pro2136Hisfs, XP_005248410.1:p.Pro1017Hisfs, XP_006714554.1:p.Pro327Hisfs, XP_011512387.1:p.Pro2136Hisfs, XP_011512388.1:p.Pro2136Hisfs, XP_011512389.1:p.Pro2136Hisfs, XP_011512390.1:p.Pro2136Hisfs, XP_011512391.1:p.Pro2136Hisfs, XP_011512392.1:p.Pro2030Hisfs, XP_011512394.1:p.Pro2136Hisfs, XP_011512396.1:p.Pro1211Hisfs, XP_016865249.1:p.Pro2073Hisfs, XP_016865250.1:p.Pro2073Hisfs, XP_016865251.1:p.Pro1912Hisfs, XP_016865252.1:p.Pro1805Hisfs, XP_016865253.1:p.Pro1805Hisfs, XP_016865254.1:p.Pro1740Hisfs, XP_016865255.1:p.Pro1017Hisfs, XR_001742208.1:n.6631delC, XR_241711.1:n.6538delC, XR_427661.3:n.6631delC, XR_925644.2:n.6631delC
    2.

    rs367543063 [Homo sapiens]
      TTTTGATGTACATACAACATTAAAA[C/T]GACATCAGAGCAAAACTAAAAGCCA
      Chromosome:
      5:37183377
      Gene:
      C5orf42 (GeneView)
      Functional Consequence:
      nc transcript variant,stop gained
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster
      HGVS:
      NC_000005.10:g.37183377G>A, NC_000005.9:g.37183479G>A, NG_032772.1:g.71052C>T, NM_023073.3:c.4804C>T, NP_075561.3:p.Arg1602Ter, XM_005248345.1:c.4804C>T, XM_005248345.3:c.4804C>T, XM_005248346.1:c.4804C>T, XM_005248346.3:c.4804C>T, XM_005248347.1:c.4804C>T, XM_005248347.3:c.4804C>T, XM_005248348.1:c.4804C>T, XM_005248349.1:c.4804C>T, XM_005248349.3:c.4804C>T, XM_005248350.1:c.4675C>T, XM_005248350.3:c.4675C>T, XM_005248351.1:c.4804C>T, XM_005248352.1:c.4804C>T, XM_005248353.1:c.1447C>T, XM_011514085.2:c.4804C>T, XM_011514086.2:c.4804C>T, XM_011514087.2:c.4804C>T, XM_011514088.2:c.4804C>T, XM_011514089.2:c.4804C>T, XM_011514090.2:c.4486C>T, XM_011514092.2:c.4804C>T, XM_011514094.2:c.2029C>T, XM_017009760.1:c.4615C>T, XM_017009761.1:c.4615C>T, XM_017009762.1:c.4132C>T, XM_017009763.1:c.3811C>T, XM_017009764.1:c.3811C>T, XM_017009765.1:c.3616C>T, XM_017009766.1:c.1447C>T, XP_005248402.1:p.Arg1602Ter, XP_005248403.1:p.Arg1602Ter, XP_005248404.1:p.Arg1602Ter, XP_005248405.1:p.Arg1602Ter, XP_005248406.1:p.Arg1602Ter, XP_005248407.1:p.Arg1559Ter, XP_005248408.1:p.Arg1602Ter, XP_005248409.1:p.Arg1602Ter, XP_005248410.1:p.Arg483Ter, XP_011512387.1:p.Arg1602Ter, XP_011512388.1:p.Arg1602Ter, XP_011512389.1:p.Arg1602Ter, XP_011512390.1:p.Arg1602Ter, XP_011512391.1:p.Arg1602Ter, XP_011512392.1:p.Arg1496Ter, XP_011512394.1:p.Arg1602Ter, XP_011512396.1:p.Arg677Ter, XP_016865249.1:p.Arg1539Ter, XP_016865250.1:p.Arg1539Ter, XP_016865251.1:p.Arg1378Ter, XP_016865252.1:p.Arg1271Ter, XP_016865253.1:p.Arg1271Ter, XP_016865254.1:p.Arg1206Ter, XP_016865255.1:p.Arg483Ter, XR_001742208.1:n.5028C>T, XR_241711.1:n.4935C>T, XR_427661.3:n.5028C>T, XR_925644.2:n.5028C>T
      4.

      rs367543061 [Homo sapiens]
        GGCTTATAGAATGCTGCCTTTCTCT[C/T]GGTTTTTTAATATGGAAGAACTTAT
        Chromosome:
        5:37187488
        Gene:
        C5orf42 (GeneView)
        Functional Consequence:
        missense,nc transcript variant
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        Pathogenic
        Validated:
        by cluster,by frequency
        HGVS:
        NC_000005.10:g.37187488G>A, NC_000005.9:g.37187590G>A, NG_032772.1:g.66941C>T, NM_023073.3:c.4006C>T, NP_075561.3:p.Arg1336Trp, XM_005248345.1:c.4006C>T, XM_005248345.3:c.4006C>T, XM_005248346.1:c.4006C>T, XM_005248346.3:c.4006C>T, XM_005248347.1:c.4006C>T, XM_005248347.3:c.4006C>T, XM_005248348.1:c.4006C>T, XM_005248349.1:c.4006C>T, XM_005248349.3:c.4006C>T, XM_005248350.1:c.3877C>T, XM_005248350.3:c.3877C>T, XM_005248351.1:c.4006C>T, XM_005248352.1:c.4006C>T, XM_005248353.1:c.649C>T, XM_011514085.2:c.4006C>T, XM_011514086.2:c.4006C>T, XM_011514087.2:c.4006C>T, XM_011514088.2:c.4006C>T, XM_011514089.2:c.4006C>T, XM_011514090.2:c.3688C>T, XM_011514092.2:c.4006C>T, XM_011514094.2:c.1231C>T, XM_017009760.1:c.3817C>T, XM_017009761.1:c.3817C>T, XM_017009762.1:c.3334C>T, XM_017009763.1:c.3013C>T, XM_017009764.1:c.3013C>T, XM_017009765.1:c.2818C>T, XM_017009766.1:c.649C>T, XP_005248402.1:p.Arg1336Trp, XP_005248403.1:p.Arg1336Trp, XP_005248404.1:p.Arg1336Trp, XP_005248405.1:p.Arg1336Trp, XP_005248406.1:p.Arg1336Trp, XP_005248407.1:p.Arg1293Trp, XP_005248408.1:p.Arg1336Trp, XP_005248409.1:p.Arg1336Trp, XP_005248410.1:p.Arg217Trp, XP_011512387.1:p.Arg1336Trp, XP_011512388.1:p.Arg1336Trp, XP_011512389.1:p.Arg1336Trp, XP_011512390.1:p.Arg1336Trp, XP_011512391.1:p.Arg1336Trp, XP_011512392.1:p.Arg1230Trp, XP_011512394.1:p.Arg1336Trp, XP_011512396.1:p.Arg411Trp, XP_016865249.1:p.Arg1273Trp, XP_016865250.1:p.Arg1273Trp, XP_016865251.1:p.Arg1112Trp, XP_016865252.1:p.Arg1005Trp, XP_016865253.1:p.Arg1005Trp, XP_016865254.1:p.Arg940Trp, XP_016865255.1:p.Arg217Trp, XR_001742208.1:n.4230C>T, XR_241711.1:n.4137C>T, XR_427661.3:n.4230C>T, XR_925644.2:n.4230C>T
        5.

        rs139675596 [Homo sapiens]
          TTATTAATTATGGAATTCTCTGGTC[A/G]AAAAGTCACATTTGGTTTTCTCCTC
          Chromosome:
          5:37165595
          Gene:
          C5orf42 (GeneView)
          Functional Consequence:
          nc transcript variant,stop gained
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          Pathogenic
          Validated:
          by cluster,by frequency
          HGVS:
          NC_000005.10:g.37165595G>A, NC_000005.9:g.37165697G>A, NG_032772.1:g.88834C>T, NM_023073.3:c.7477C>T, NP_075561.3:p.Arg2493Ter, XM_005248345.1:c.7477C>T, XM_005248345.3:c.7477C>T, XM_005248346.1:c.7474C>T, XM_005248346.3:c.7474C>T, XM_005248347.1:c.7474C>T, XM_005248347.3:c.7474C>T, XM_005248348.1:c.7477C>T, XM_005248349.1:c.7474C>T, XM_005248349.3:c.7474C>T, XM_005248350.1:c.7348C>T, XM_005248350.3:c.7348C>T, XM_005248351.1:c.7477C>T, XM_005248352.1:c.7477C>T, XM_005248353.1:c.4120C>T, XM_006714491.3:c.2050C>T, XM_011514085.2:c.7477C>T, XM_011514086.2:c.7477C>T, XM_011514087.2:c.7477C>T, XM_011514088.2:c.7477C>T, XM_011514089.2:c.7477C>T, XM_011514090.2:c.7159C>T, XM_011514092.2:c.7477C>T, XM_011514094.2:c.4702C>T, XM_017009760.1:c.7288C>T, XM_017009761.1:c.7288C>T, XM_017009762.1:c.6805C>T, XM_017009763.1:c.6484C>T, XM_017009764.1:c.6484C>T, XM_017009765.1:c.6289C>T, XM_017009766.1:c.4120C>T, XP_005248402.1:p.Arg2493Ter, XP_005248403.1:p.Arg2492Ter, XP_005248404.1:p.Arg2492Ter, XP_005248405.1:p.Arg2493Ter, XP_005248406.1:p.Arg2492Ter, XP_005248407.1:p.Arg2450Ter, XP_005248408.1:p.Arg2493Ter, XP_005248409.1:p.Arg2493Ter, XP_005248410.1:p.Arg1374Ter, XP_006714554.1:p.Arg684Ter, XP_011512387.1:p.Arg2493Ter, XP_011512388.1:p.Arg2493Ter, XP_011512389.1:p.Arg2493Ter, XP_011512390.1:p.Arg2493Ter, XP_011512391.1:p.Arg2493Ter, XP_011512392.1:p.Arg2387Ter, XP_011512394.1:p.Arg2493Ter, XP_011512396.1:p.Arg1568Ter, XP_016865249.1:p.Arg2430Ter, XP_016865250.1:p.Arg2430Ter, XP_016865251.1:p.Arg2269Ter, XP_016865252.1:p.Arg2162Ter, XP_016865253.1:p.Arg2162Ter, XP_016865254.1:p.Arg2097Ter, XP_016865255.1:p.Arg1374Ter, XR_001742208.1:n.7701C>T, XR_241711.1:n.7608C>T, XR_427661.3:n.7701C>T, XR_925644.2:n.7701C>T
          6.

          rs111294855 [Homo sapiens]
            GGCTCCTTCACTTCTGTAATGCCTG[C/T]TCTCAAGCTTTTTCCATCCAGACAA
            Chromosome:
            5:37157382
            Gene:
            C5orf42 (GeneView)
            Functional Consequence:
            intron variant,missense,nc transcript variant
            Allele Origin:
            T(germline)/C(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            T=0.0006/3
            HGVS:
            NC_000005.10:g.37157382C>T, NC_000005.9:g.37157484C>T, NG_032772.1:g.97047G>A, NM_023073.3:c.7957+288G>A, XM_005248345.1:c.8050G>A, XM_005248345.3:c.8050G>A, XM_005248346.1:c.8047G>A, XM_005248346.3:c.8047G>A, XM_005248347.1:c.8047G>A, XM_005248347.3:c.8047G>A, XM_005248348.1:c.7996G>A, XM_005248349.1:c.8008+288G>A, XM_005248349.3:c.8008+288G>A, XM_005248350.1:c.7921G>A, XM_005248350.3:c.7921G>A, XM_005248351.1:c.8050G>A, XM_005248353.1:c.4693G>A, XM_006714491.3:c.2623G>A, XM_011514085.2:c.8050G>A, XM_011514086.2:c.8050G>A, XM_011514087.2:c.7996G>A, XM_011514088.2:c.8011+288G>A, XM_011514089.2:c.8050G>A, XM_011514090.2:c.7732G>A, XM_011514092.2:c.8050G>A, XM_011514094.2:c.5275G>A, XM_017009760.1:c.7861G>A, XM_017009761.1:c.7861G>A, XM_017009762.1:c.7378G>A, XM_017009763.1:c.7057G>A, XM_017009764.1:c.7057G>A, XM_017009765.1:c.6862G>A, XM_017009766.1:c.4693G>A, XP_005248402.1:p.Ala2684Thr, XP_005248403.1:p.Ala2683Thr, XP_005248404.1:p.Ala2683Thr, XP_005248405.1:p.Ala2666Thr, XP_005248407.1:p.Ala2641Thr, XP_005248408.1:p.Ala2684Thr, XP_005248410.1:p.Ala1565Thr, XP_006714554.1:p.Ala875Thr, XP_011512387.1:p.Ala2684Thr, XP_011512388.1:p.Ala2684Thr, XP_011512389.1:p.Ala2666Thr, XP_011512391.1:p.Ala2684Thr, XP_011512392.1:p.Ala2578Thr, XP_011512394.1:p.Ala2684Thr, XP_011512396.1:p.Ala1759Thr, XP_016865249.1:p.Ala2621Thr, XP_016865250.1:p.Ala2621Thr, XP_016865251.1:p.Ala2460Thr, XP_016865252.1:p.Ala2353Thr, XP_016865253.1:p.Ala2353Thr, XP_016865254.1:p.Ala2288Thr, XP_016865255.1:p.Ala1565Thr, XR_001742208.1:n.8219G>A, XR_241711.1:n.8181G>A, XR_427661.3:n.8274G>A, XR_925644.2:n.8274G>A

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center