Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

1.

rs876657740 [Homo sapiens]
    GTCCCTTCTCAGATTATGTTTGAGA[C/T]CTTCAACACCCCGGCCATGTACGTG
    Chromosome:
    17:81511613
    Gene:
    ACTG1 (GeneView) FSCN2 (GeneView)
    Functional Consequence:
    missense,nc transcript variant,upstream variant 2KB
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Uncertain significance
    Validated:
    no info
    HGVS:
    NC_000017.10:g.79478639G>A, NC_000017.11:g.81511613G>A, NG_011433.1:g.6189C>T, NM_001199954.1:c.377C>T, NM_001614.3:c.377C>T, NP_001186883.1:p.Thr126Ile, NP_001605.1:p.Thr126Ile, NR_037688.1:n.516C>T, NW_003871087.1:g.166251G>A, XM_011524590.2:c.-5479G>A, XR_001752466.1:n.-1406G>A
    2.

    rs281875334 [Homo sapiens]
      TACCTCATGAAGATCCTCACCGAGC[A/G]CGGCTACAGCTTCACCACCACGGCC
      Chromosome:
      7:5528496
      Gene:
      ACTB (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Pathogenic
      Validated:
      no info
      HGVS:
      NC_000007.13:g.5568127C>T, NC_000007.14:g.5528496C>T, NG_007992.1:g.7106G>A, NM_001101.3:c.587G>A, NP_001092.1:p.Arg196His, XM_005249818.1:c.587G>A, XM_005249819.1:c.344G>A, XM_005249820.1:c.221G>A, XP_005249875.1:p.Arg196His, XP_005249876.1:p.Arg115His, XP_005249877.1:p.Arg74His
      8.

      rs281875327 [Homo sapiens]
        GAGCGAGGCTACAGCTTCACCACCA[A/C]GGCCGAGCGGGAAATCGTGCGCGAC
        Chromosome:
        17:81511382
        Gene:
        ACTG1 (GeneView) FSCN2 (GeneView)
        Functional Consequence:
        missense,nc transcript variant,upstream variant 2KB
        Allele Origin:
        A(germline)/C(germline)
        Clinical significance:
        Pathogenic
        Validated:
        no info
        HGVS:
        NC_000017.10:g.79478408G>T, NC_000017.11:g.81511382G>T, NG_011433.1:g.6420C>A, NM_001199954.1:c.608C>A, NM_001614.3:c.608C>A, NP_001186883.1:p.Thr203Lys, NP_001605.1:p.Thr203Lys, NR_037688.1:n.747C>A, NW_003871087.1:g.166020G>T, XM_011524590.2:c.-5710G>T, XR_001752466.1:n.-1637G>T
        9.

        rs281875326 [Homo sapiens]
          CGCACCACTGGCATTGTCATGGACT[C/T]TGGAGACGGGGTCACCCACACGGTG
          Chromosome:
          17:81511526
          Gene:
          ACTG1 (GeneView) FSCN2 (GeneView)
          Functional Consequence:
          missense,nc transcript variant,upstream variant 2KB
          Allele Origin:
          T(germline)/C(germline)
          Clinical significance:
          Pathogenic
          Validated:
          no info
          HGVS:
          NC_000017.10:g.79478552G>A, NC_000017.11:g.81511526G>A, NG_011433.1:g.6276C>T, NM_001199954.1:c.464C>T, NM_001614.3:c.464C>T, NP_001186883.1:p.Ser155Phe, NP_001605.1:p.Ser155Phe, NR_037688.1:n.603C>T, NW_003871087.1:g.166164G>A, XM_011524590.2:c.-5566G>A, XR_001752466.1:n.-1493G>A
          10.

          rs281875325 [Homo sapiens]
            CCCAAGGCCAACAGAGAGAAGATGA[C/T]TCAGGTGAGGCTCGGCCGACGCCCG
            Chromosome:
            17:81511907
            Gene:
            ACTG1 (GeneView) FSCN2 (GeneView)
            Functional Consequence:
            missense,nc transcript variant,upstream variant 2KB
            Allele Origin:
            T(germline)/C(germline)
            Clinical significance:
            Pathogenic
            Validated:
            no info
            HGVS:
            NC_000017.10:g.79478933G>A, NC_000017.11:g.81511907G>A, NG_011433.1:g.5895C>T, NM_001199954.1:c.359C>T, NM_001614.3:c.359C>T, NP_001186883.1:p.Thr120Ile, NP_001605.1:p.Thr120Ile, NR_037688.1:n.498C>T, NW_003871087.1:g.166545G>A, XM_011524590.2:c.-5185G>A, XR_001752466.1:n.-1112G>A
            11.

            rs104894003 [Homo sapiens]
              CATCCTGCGTCTGGACCTGGCTGGC[C/T]GGGACCTGACTGACTACCTCATGAA
              Chromosome:
              7:5528536
              Gene:
              ACTB (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              T(germline)/C(germline)
              Clinical significance:
              Pathogenic
              Validated:
              by cluster
              HGVS:
              NC_000007.13:g.5568167G>A, NC_000007.14:g.5528536G>A, NG_007992.1:g.7066C>T, NM_001101.3:c.547C>T, NP_001092.1:p.Arg183Trp, XM_005249818.1:c.547C>T, XM_005249819.1:c.304C>T, XM_005249820.1:c.181C>T, XP_005249875.1:p.Arg183Trp, XP_005249876.1:p.Arg102Trp, XP_005249877.1:p.Arg61Trp
              12.

              rs11549190 [Homo sapiens]
                TTCAACACCCCGGCCATGTACGTGG[C/T]CATCCAGGCCGTGCTGTCCCTCTAC
                Chromosome:
                17:81511586
                Gene:
                ACTG1 (GeneView) FSCN2 (GeneView)
                Functional Consequence:
                missense,nc transcript variant,upstream variant 2KB
                Allele Origin:
                T(germline)/C(germline)
                Clinical significance:
                Pathogenic
                Validated:
                by cluster
                HGVS:
                NC_000017.10:g.79478612G>A, NC_000017.11:g.81511586G>A, NG_011433.1:g.6216C>T, NM_001199954.1:c.404C>T, NM_001614.3:c.404C>T, NP_001186883.1:p.Ala135Val, NP_001605.1:p.Ala135Val, NR_037688.1:n.543C>T, NW_003871087.1:g.166224G>A, XM_011524590.2:c.-5506G>A, XR_001752466.1:n.-1433G>A

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center