Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 19

2.

rs12461110 [Homo sapiens]
    GTAACGGTCTTTATGAGTGTTGCTC[A/G]GCAAAAGAATATTCGCGGCCTGCAA
    Chromosome:
    19:55809297
    Gene:
    NLRP11 (GeneView)
    Functional Consequence:
    missense
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2338/1171
    HGVS:
    NC_000019.10:g.55809297G>A, NC_000019.9:g.56320663G>A, NM_001297743.1:c.1016C>T, NM_145007.3:c.1313C>T, NP_001284672.1:p.Pro339Leu, NP_659444.2:p.Pro438Leu, XM_005258632.1:c.1016C>T, XM_005258633.1:c.-77C>T, XP_005258689.1:p.Pro339Leu, XR_243912.1:n.1701C>T, XR_243913.1:n.1691C>T
    3.

    rs12294104 [Homo sapiens]
      CATCCATGACAATGTCACACACACA[C/T]GAGAGCATGAAGCACACCCAGGTAA
      Chromosome:
      11:30361352
      Gene:
      LOC102723403 (GeneView)
      Functional Consequence:
      nc transcript variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1072/537
      HGVS:
      NC_000011.10:g.30361352C>T, NC_000011.9:g.30382899C>T, XR_001748160.1:n.1562G>A, XR_001748161.1:n.1491G>A, XR_001748162.1:n.1491G>A, XR_428889.3:n.1491G>A, XR_931154.2:n.1491G>A
      5.

      rs10852344 [Homo sapiens]
        cctctctaccatttctgcaactttt[C/T]gtgagtctgtaattatttcaaagta
        Chromosome:
        16:11923062
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2953/1479
        HGVS:
        NC_000016.10:g.11923062C>T, NC_000016.9:g.12016919C>T
        6.

        rs10183486 [Homo sapiens]
          TATAGTTGGCTAACAACTTGACTAA[C/T]GATTGGGCAAAGAATCTGAACAGAC
          Chromosome:
          2:171134461
          Gene:
          TLK1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.3157/1581
          HGVS:
          NC_000002.11:g.171990971C>T, NC_000002.12:g.171134461C>T, NM_001136554.1:c.-5-16604G>A, NM_012290.4:c.140-16604G>A, XM_005246980.1:c.140-16604G>A, XM_011512238.2:c.140-16604G>A, XM_017005421.1:c.-581-16604G>A, XM_017005422.1:c.-394+25829G>A, XR_001739084.1:n.652-16604G>A, XR_001739085.1:n.652-16604G>A
          9.

          rs4246511 [Homo sapiens]
            CATTAATATTCCTAAATACTAATAT[C/T]GGGCAGTTATAATGcaatataaagt
            Chromosome:
            1:38914713
            Gene:
            LOC105378662 (GeneView) RHBDL2 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4475/2241
            HGVS:
            NC_000001.10:g.39380385T>C, NC_000001.11:g.38914713T>C, NM_001304746.1:c.635+849A>G, NM_017821.4:c.395+849A>G, XM_005270971.1:c.635+849A>G, XM_005270972.1:c.596+849A>G, XR_001737994.1:n.89+1085T>C, XR_947215.1:n.-512T>C
            10.

            rs3736830 [Homo sapiens]
              TTATTTGGGTTGTTTTAAAATATTA[C/G]TAATAAAAAATCCTAATAAAGACTA
              Chromosome:
              13:49732085
              Gene:
              KPNA3 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.3636/1821
              HGVS:
              NC_000013.10:g.50306221G>C, NC_000013.11:g.49732085G>C, NM_002267.3:c.383+286C>G, XM_017020561.1:c.311+286C>G
              11.

              rs2517388 [Homo sapiens]
                GTACAAAATTTATAGTAGTAACAAG[G/T]ATAGTGTCTTCTGGTGATAAGCCTG
                Chromosome:
                8:38120214
                Gene:
                ASH2L (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.3558/1782
                HGVS:
                NC_000008.10:g.37977732T>G, NC_000008.11:g.38120214T>G, NM_001105214.2:c.666-718T>G, NM_001261832.1:c.666-718T>G, NM_001282272.1:c.531-718T>G, NM_004674.4:c.948-718T>G, NR_049736.1:n.860-718T>G, XM_005273682.1:c.966-718T>G, XM_005273683.1:c.684-718T>G, XM_005273684.1:c.531-718T>G, XM_006716412.1:c.966-718T>G, XM_006716413.2:c.948-718T>G
                12.

                rs2307449 [Homo sapiens]
                  GCCTGCTTTACTGTCCTTTAGTACT[A/C]CCATCTGTTCTATCTCCTGCCCATT
                  Chromosome:
                  15:89320697
                  Gene:
                  POLG (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4483/2245
                  HGVS:
                  NC_000015.10:g.89320697T>G, NC_000015.9:g.89863928T>G, NG_008218.2:g.19099A>C, NM_001126131.1:c.2981+69A>C, NM_002693.2:c.2981+69A>C
                  13.

                  rs2303369 [Homo sapiens]
                    GTGCCACCCTTTCTCTCCAGCCTCC[C/T]CCATCCCAGATCTTCCATTCTCCAT
                    Chromosome:
                    2:27492549
                    Gene:
                    FNDC4 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3546/1776
                    HGVS:
                    NC_000002.11:g.27715416C>T, NC_000002.12:g.27492549C>T, NG_028024.1:g.711C>T, NG_034068.1:g.2263G>A, NM_022823.2:c.670-71G>A, XM_005264499.1:c.545-71G>A, XM_005264499.3:c.545-71G>A
                    14.

                    rs2277339 [Homo sapiens]
                      AAGCAGCTCGGGCAGCTCGGTGGGG[G/T]CAAACGTCTCCATTGAGCGCGGAAC
                      Chromosome:
                      12:56752285
                      Gene:
                      HSD17B6 (GeneView) PRIM1 (GeneView)
                      Functional Consequence:
                      missense,upstream variant 2KB
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.1484/743
                      HGVS:
                      NC_000012.11:g.57146069T>G, NC_000012.12:g.56752285T>G, NM_000946.2:c.14A>C, NP_000937.1:p.Asp5Ala, XM_005269207.1:c.-533T>G, XM_005269208.1:c.-541T>G, XM_005269209.1:c.-528T>G, XM_005269210.1:c.-508T>G, XM_006719672.1:c.-536T>G, XM_011538925.1:c.-527T>G, XM_011538926.1:c.-513T>G, XM_011538927.1:c.-508T>G, XR_001748907.1:n.-168T>G, XR_245961.1:n.-168T>G
                      15.

                      rs2153157 [Homo sapiens]
                        GCCTCAGGCCTAGGTATCTTTCTTT[C/T]GTTAAAAAGCTTCCAGCTAATTAGA
                        Chromosome:
                        6:10897255
                        Gene:
                        SYCP2L (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.4201/2104
                        HGVS:
                        NC_000006.11:g.10897488G>A, NC_000006.12:g.10897255G>A, NM_001040274.2:c.337-756G>A
                        17.

                        rs1046089 [Homo sapiens]
                          CCCATTGGCACAGAACGATCACAGC[A/G]TACAGACCGAGGCACAGAGCCTGGC
                          Chromosome:
                          6:31635190
                          Gene:
                          PRRC2A (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.3902/1954
                          HGVS:
                          NC_000006.11:g.31602967G>A, NC_000006.12:g.31635190G>A, NM_004638.3:c.5219G>A, NM_080686.2:c.5219G>A, NP_004629.3:p.Arg1740His, NP_542417.2:p.Arg1740His, NT_113891.3:g.3112477A, NT_113891.3:g.3112477A>G, NT_167245.2:g.2882954G>A, NT_167246.2:g.2940231G>A, NT_167247.2:g.2977070G>A, NT_167248.2:g.2891008A, NT_167248.2:g.2891008A>G, NT_167249.2:g.2934471A, NT_167249.2:g.2934471A>G, XM_005249392.1:c.5219G>A, XM_005272878.1:c.5216A, XM_005272878.1:c.5216A>G, XM_005272879.1:c.5219A, XM_005272879.1:c.5219A>G, XM_005275032.1:c.5216G>A, XM_005275033.1:c.5219G>A, XM_005275167.1:c.5216G>A, XM_005275168.1:c.5219G>A, XM_005275291.1:c.5216G>A, XM_005275462.1:c.5216A, XM_005275462.1:c.5216A>G, XM_005275463.1:c.5219A, XM_005275463.1:c.5219A>G, XM_005275595.1:c.5216A, XM_005275595.1:c.5216A>G, XM_005275596.1:c.5219A, XM_005275596.1:c.5219A>G, XM_017011274.1:c.5219G>A, XP_005249449.1:p.Arg1740His, XP_005272935.1:p.His1739, XP_005272935.1:p.His1739Arg, XP_005272936.1:p.His1740, XP_005272936.1:p.His1740Arg, XP_005275089.1:p.Arg1739His, XP_005275090.1:p.Arg1740His, XP_005275224.1:p.Arg1739His, XP_005275225.1:p.Arg1740His, XP_005275348.1:p.Arg1739His, XP_005275519.1:p.His1739, XP_005275519.1:p.His1739Arg, XP_005275520.1:p.His1740, XP_005275520.1:p.His1740Arg, XP_005275652.1:p.His1739, XP_005275652.1:p.His1739Arg, XP_005275653.1:p.His1740, XP_005275653.1:p.His1740Arg, XP_016866763.1:p.Arg1740His
                          19.

                          rs365132 [Homo sapiens]
                            CAAAAGTTTCAGAGGAACTTAGCTG[G/T]GTCTCTGTAATTTAAAAAAGTTAAA
                            Chromosome:
                            5:176951573
                            Gene:
                            UIMC1 (GeneView)
                            Functional Consequence:
                            nc transcript variant,synonymous codon
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.4115/2061
                            HGVS:
                            NC_000005.10:g.176951573G>T, NC_000005.9:g.176378574G>T, NM_001199297.2:c.1344C>A, NM_001199298.1:c.1344C>A, NM_001317961.1:c.846C>A, NM_016290.4:c.1344C>A, NP_001186226.1:p.Thr448, NP_001186227.1:p.Thr448, NP_001304890.1:p.Thr282, NP_057374.3:p.Thr448, XM_005265930.1:c.1344C>A, XM_005265930.2:c.1344C>A, XM_005265931.1:c.1047C>A, XM_005265932.1:c.501C>A, XM_005265932.2:c.501C>A, XM_005265933.1:c.501C>A, XM_005265933.2:c.501C>A, XM_005265934.1:c.435C>A, XM_005265934.2:c.435C>A, XM_005265935.1:c.435C>A, XM_005265935.2:c.435C>A, XM_005265936.1:c.234C>A, XM_005265936.2:c.234C>A, XM_006714871.2:c.1344C>A, XM_006714874.2:c.435C>A, XM_011534568.2:c.1344C>A, XM_011534570.1:c.1344C>A, XM_017009574.1:c.1110C>A, XM_017009575.1:c.1047C>A, XM_017009576.1:c.501C>A, XM_017009577.1:c.501C>A, XM_017009578.1:c.234C>A, XM_017009579.1:c.234C>A, XP_005265987.1:p.Thr448, XP_005265988.1:p.Thr349, XP_005265989.1:p.Thr167, XP_005265990.1:p.Thr167, XP_005265991.1:p.Thr145, XP_005265992.1:p.Thr145, XP_005265993.1:p.Thr78, XP_006714934.1:p.Thr448, XP_006714937.1:p.Thr145, XP_011532870.1:p.Thr448, XP_011532872.1:p.Thr448, XP_016865063.1:p.Thr370, XP_016865064.1:p.Thr349, XP_016865065.1:p.Thr167, XP_016865066.1:p.Thr167, XP_016865067.1:p.Thr78, XP_016865068.1:p.Thr78, XR_001742115.1:n.1476C>A, XR_941103.2:n.1476C>A

                            Display Settings:

                            Format
                            Items per page
                            Sort by

                            Send to:

                            Choose Destination

                            Supplemental Content

                            Find related data

                            Recent activity

                            Your browsing activity is empty.

                            Activity recording is turned off.

                            Turn recording back on

                            See more...
                            Support Center