Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 8

1.

rs17690388 [Homo sapiens]
    CCAGACACACATTCAAAGTGTAAAT[A/G]TTACTCCCTCAGAGCTCAAGTTATT
    Chromosome:
    7:92716043
    Gene:
    CDK6 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0098/49
    HGVS:
    NC_000007.13:g.92345357G>A, NC_000007.14:g.92716043G>A, NG_015888.1:g.125585C>T, NM_001145306.1:c.537+9583C>T, NM_001259.6:c.537+9583C>T, XM_005250106.1:c.538-5169C>T, XM_006715835.2:c.537+9583C>T
    2.
    3.

    rs12513877 [Homo sapiens]
      TTATTGACCAACTTATGAGCATCCT[A/G]GGCAAAAATAGCATTTTACCTTTGC
      Chromosome:
      5:58456699
      Gene:
      PLK2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1184/593
      HGVS:
      NC_000005.10:g.58456699G>A, NC_000005.9:g.57752526G>A, NM_001252226.1:c.1115-110C>T, NM_006622.3:c.1157-110C>T
      5.

      rs3731348 [Homo sapiens]
        AATGTTGAAAATTACCTGTTTATGG[A/C]ATTTGTTGAGGAAGGAATCAGGGAA
        Chromosome:
        7:92623919
        Gene:
        CDK6 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0282/141
        HGVS:
        NC_000007.13:g.92253233G>T, NC_000007.14:g.92623919G>T, NG_015888.1:g.217709C>A, NM_001145306.1:c.648-833C>A, NM_001259.6:c.648-833C>A, XM_006715835.2:c.648-833C>A
        6.

        rs2282990 [Homo sapiens]
          GACAGTTAATAACATTTCAGCTTCT[C/G/T]GAAGAATGCTTAATAGTAATCATAA
          Chromosome:
          7:92697154
          Gene:
          CDK6 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1318/660
          HGVS:
          NC_000007.13:g.92326468C>T, NC_000007.14:g.92697154C>G, NC_000007.14:g.92697154C>T, NG_015888.1:g.144474G>A, NG_015888.1:g.144474G>C, NM_001145306.1:c.538-25619G>A, NM_001145306.1:c.538-25619G>C, NM_001259.6:c.538-25619G>A, NM_001259.6:c.538-25619G>C, XM_006715835.2:c.538-25619G>A, XM_006715835.2:c.538-25619G>C
          7.

          rs2282983 [Homo sapiens]
            AAACAATCTCCCCTTTGTATAGTTT[C/T]TTCTTCTCACCAATTTGTTACTATA
            Chromosome:
            7:92650049
            Gene:
            CDK6 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4295/2151
            HGVS:
            NC_000007.13:g.92279363T>C, NC_000007.14:g.92650049T>C, NG_015888.1:g.191579A>G, NM_001145306.1:c.647+21377A>G, NM_001259.6:c.647+21377A>G, XM_006715835.2:c.647+21377A>G
            8.

            rs2125846 [Homo sapiens]
              GAGAAACACTTTTATGATGTCTGCT[A/G]GTACCAGGGTAATTAAATCTCAAAG
              Chromosome:
              17:28171022
              Gene:
              NLK (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              C=0.2242/1123
              HGVS:
              NC_000017.10:g.26498048T>C, NC_000017.11:g.28171022T>C, NM_016231.4:c.1048-1495T>C, XM_005257988.1:c.1048-1495T>C, XM_005257988.2:c.1048-1495T>C, XR_001752526.1:n.1275-1495T>C, XR_934482.1:n.1275-1495T>C

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center