Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs11856574 [Homo sapiens]
    gtaggggcagggaaagcatcagaat[A/G]taagatgaaccaggagcatcttata
    Chromosome:
    15:29439240
    Gene:
    FAM189A1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2143/1073
    HGVS:
    NC_000015.10:g.29439240G>A, NC_000015.9:g.29731444G>A, NM_015307.1:c.220-57409C>T, NT_187660.1:g.1714733G>A, NW_011332701.1:g.1602249G>A, XM_005254261.1:c.103-57409C>T, XM_011521407.2:c.103-57409C>T
    2.

    rs6565373 [Homo sapiens]
      gacccccaggatcgtcagggcctcc[C/T]acagctggagtgggaagggagcaga
      Chromosome:
      16:88226436
      Validated:
      by 2hit 2allele,by frequency,by hapmap
      HGVS:
      NC_000016.10:g.88226436C>T, NC_000016.9:g.88260042C>T
      3.

      rs3848198 [Homo sapiens]
        tgctttattgtatggatgtaacttt[A/G]tttttccagtcccctactggtgaac
        Chromosome:
        15:80347222
        Gene:
        LOC101929560 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.4445/2226
        HGVS:
        NC_000015.10:g.80347222T>C, NC_000015.9:g.80639564T>C, XR_243193.1:n.445+477A>G, XR_932523.2:n.176+477A>G
        4.

        rs2854357 [Homo sapiens]
          TAGAAACTTTATTTTTGAATGTATA[C/T]ATTGAATGTGTTTTATGTATAAAGG
          Chromosome:
          13:48375917
          Gene:
          RB1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          T=0.2690/1347
          HGVS:
          NC_000013.10:g.48950053T>C, NC_000013.11:g.48375917T>C, NG_009009.1:g.77171T>C, NM_000321.2:c.1216-1001T>C, XM_011535171.2:c.955-1001T>C
          5.

          rs482329 [Homo sapiens]
            gcggtgatggttgctactttttatg[A/C/G]agggtttttgaaggcgtctctcata
            Chromosome:
            1:234680808
            Gene:
            LOC105373208 (GeneView) LOC105373209 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4690/2349
            HGVS:
            NC_000001.10:g.234816554G>C, NC_000001.11:g.234680808G>A, NC_000001.11:g.234680808G>C, XR_001738531.1:n.1835-1459C>G, XR_001738531.1:n.1835-1459C>T, XR_949287.2:n.148-1459C>G, XR_949287.2:n.148-1459C>T, XR_949288.2:n.1160-3G>A, XR_949288.2:n.1160-3G>C, XR_949289.2:n.699-3G>A, XR_949289.2:n.699-3G>C

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center