Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs3811647 [Homo sapiens]
    AGCTGAGGGAGTTTACAGACAGATC[A/G]TCTAGGATTATACATCTAGGAAGGG
    Chromosome:
    3:133765185
    Gene:
    TF (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3407/1706
    HGVS:
    NC_000003.11:g.133484029G>A, NC_000003.12:g.133765185G>A, NG_013080.1:g.24053G>A, NM_001063.3:c.1330+278G>A, XM_005247730.1:c.949+278G>A, XM_017007089.1:c.1330+278G>A, XM_017007090.1:c.1330+278G>A
    2.

    rs2280673 [Homo sapiens]
      CCGCCCCTGCCTGGTGGTGGAAGAC[A/C/T]GGGCTTCACAGATGAGATACCCATG
      Chromosome:
      3:133839310
      Gene:
      RAB6B (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4876/2442
      HGVS:
      NC_000003.11:g.133558154A>C, NC_000003.12:g.133839310A>C, NC_000003.12:g.133839310A>T, NM_016577.3:c.401+196T>A, NM_016577.3:c.401+196T>G, XM_011512893.2:c.362+196T>A, XM_011512893.2:c.362+196T>G
      4.

      rs1799852 [Homo sapiens]
        CAGGGACCAGTATGAGCTGCTTTGC[C/T]TGGACAACACCCGGAAGCCGGTAGA
        Chromosome:
        3:133756878
        Gene:
        TF (GeneView)
        Functional Consequence:
        synonymous codon
        Clinical significance:
        Benign
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1426/714
        HGVS:
        NC_000003.11:g.133475722C>T, NC_000003.12:g.133756878C>T, NG_013080.1:g.15746C>T, NM_001063.3:c.739C>T, NP_001054.1:p.Leu247, XM_005247730.1:c.358C>T, XM_017007089.1:c.739C>T, XM_017007090.1:c.739C>T, XP_005247787.1:p.Leu120, XP_016862578.1:p.Leu247, XP_016862579.1:p.Leu247

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center