Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 84

1.
2.

rs17696736 [Homo sapiens]
    AAGTAAGACACCAAACAAAAGACCT[A/G]TCAAAATTCATGTCATAATCTATTC
    Chromosome:
    12:112049014
    Gene:
    NAA25 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1358/680
    HGVS:
    NC_000012.11:g.112486818A>G, NC_000012.12:g.112049014A>G, NG_017071.1:g.64818T>C, NM_024953.3:c.1729-571T>C, XM_005253938.1:c.1321-571T>C, XM_006719606.1:c.1645-571T>C, XR_243023.1:n.2106+469T>C, XR_243023.2:n.2106+469T>C, XR_944730.1:n.1982-571T>C, XR_944731.1:n.2110+469T>C
    3.

    rs17582416 [Homo sapiens]
      GACTTCAAGATGAATTACATGTAGA[G/T]TGTGAAAGACATGAGTAAAGGGCCG
      Chromosome:
      10:34998722
      Gene:
      LOC105376492 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2967/1486
      HGVS:
      NC_000010.10:g.35287650T>G, NC_000010.11:g.34998722T>G, XR_930817.1:n.509-4360A>C
      4.

      rs17445836 [Homo sapiens]
        AGCCCGGGTCCTGGATCCCAGCTGC[A/G]GGCTCACCTTCTAGCACCCTCCCAG
        Chromosome:
        16:85984057
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0861/431
        HGVS:
        NC_000016.10:g.85984057G>A, NC_000016.9:g.86017663G>A
        5.

        rs17035378 [Homo sapiens]
          TTTTTTTTTGACAGCCCACATCAAA[C/T]TGCTGACTCATAGAGCTCCTTTTTT
          Chromosome:
          2:68371823
          Gene:
          LOC101927723 (GeneView) PLEK (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4814/2411
          HGVS:
          NC_000002.11:g.68598955T>C, NC_000002.12:g.68371823T>C, NM_002664.2:c.42+6430T>C, XM_005264370.1:c.42+6430T>C, XM_011532916.1:c.42+6430T>C, XR_245020.2:n.-1318A>G
          6.

          rs13017599 [Homo sapiens]
            GTTGCCGTCGTTTTTGCATCTCTTG[A/G]TTGTTCAGCTTTTCCATCCTCCACA
            Chromosome:
            2:60937196
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.1260/631
            HGVS:
            NC_000002.11:g.61164331G>A, NC_000002.12:g.60937196G>A, NG_009843.2:g.873C>T, XM_005264472.1:c.923-6998G>A
            8.

            rs12928822 [Homo sapiens]
              accagagtctgtttctgtgaccaaa[C/T]gtcctataaacagaatcacgtggtg
              Chromosome:
              16:11310036
              Gene:
              LOC105371082 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.0837/419
              HGVS:
              NC_000016.10:g.11310036C>T, NC_000016.9:g.11403893C>T, XR_933070.1:n.733+60258C>T
              9.

              rs12722489 [Homo sapiens]
                CTAGCTATTGGTGACTTATCCAAGG[A/G]TCTGAGTGGTCTTGGAGGGAGCAGG
                Chromosome:
                10:6060049
                Gene:
                IL2RA (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.0911/456
                HGVS:
                NC_000010.10:g.6102012C>T, NC_000010.11:g.6060049C>T, NG_007403.1:g.7261G>A, NM_000417.2:c.64+2039G>A, NM_001308242.1:c.64+2039G>A, NM_001308243.1:c.64+2039G>A, XM_005252446.1:c.64+2039G>A, XM_005252447.1:c.64+2039G>A
                11.

                rs12122721 [Homo sapiens]
                  AGAACCAGACAGCTGGACTAGAATC[A/G]CCTTTCAGATGGCCAAAATGTTAGT
                  Chromosome:
                  1:201015352
                  Gene:
                  KIF21B (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.1875/939
                  HGVS:
                  NC_000001.10:g.200984480G>A, NC_000001.11:g.201015352G>A, NM_001252100.1:c.42-5864C>T, NM_001252102.1:c.42-5864C>T, NM_001252103.1:c.42-5864C>T, NM_017596.3:c.42-5864C>T, XR_921754.1:n.148-5864C>T, XR_921755.1:n.149-5864C>T
                  12.

                  rs11860650 [Homo sapiens]
                    ccaatgtcatgaagctttccctcta[C/T]gtttccttctaatagtttatagtgt
                    Chromosome:
                    16:31315385
                    Gene:
                    ITGAM (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    Global MAF:
                    T=0.1468/735
                    HGVS:
                    NC_000016.10:g.31315385C>T, NC_000016.9:g.31326706C>T, NG_011719.1:g.60419C>T, NM_000632.3:c.1708-5856C>T, NM_001145808.1:c.1711-5856C>T, XM_006721045.1:c.1708-5856C>T, XM_011545850.1:c.1525-5856C>T, XM_011545851.1:c.1711-5856C>T, XR_950796.1:n.1801-5856C>T
                    13.

                    rs11755527 [Homo sapiens]
                      AAGGGCTGGGAAAGAAAGGAGAAAG[C/G]AAAGTATGGACAACTGGGTGGTGCT
                      Chromosome:
                      6:90248512
                      Gene:
                      BACH2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.3666/1836
                      HGVS:
                      NC_000006.11:g.90958231C>G, NC_000006.12:g.90248512C>G, NM_001170794.1:c.-274-41831G>C, NM_021813.3:c.-275+4001G>C, XM_011536037.1:c.-275+23337G>C, XM_011536038.1:c.-354-41831G>C, XM_011536039.1:c.-275+4001G>C, XM_011536041.1:c.-269-41836G>C, XM_011536042.1:c.-73-41831G>C, XM_011536043.1:c.-73-41831G>C
                      14.

                      rs11584383 [Homo sapiens]
                        TGGCCTTCTGGGGTAGAGCCACTTG[C/T]AAGCCGCCTTCTTGCCTATGCACAT
                        Chromosome:
                        1:200966738
                        Gene:
                        MROH3P (GeneView)
                        Functional Consequence:
                        downstream variant 500B
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.1536/769
                        HGVS:
                        NC_000001.10:g.200935866T>C, NC_000001.11:g.200966738T>C, XR_241169.1:n.2348T>C, XR_241169.2:n.3045T>C
                        15.

                        rs10995271 [Homo sapiens]
                          CTCCAGTCACCAGCTAACTCATGCT[C/G]TCTCTCAGGTCTCAGATGAAATGCA
                          Chromosome:
                          10:62678726
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.3203/1604
                          HGVS:
                          NC_000010.10:g.64438486G>C, NC_000010.11:g.62678726G>C
                          16.

                          rs10903122 [Homo sapiens]
                            TGTTTGAGGTAAGAATTCCCAATGC[A/G]TCTTATGTTTGGGAAGACTTAATTT
                            Chromosome:
                            1:24977085
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.3610/1808
                            HGVS:
                            NC_000001.10:g.25303576A>G, NC_000001.11:g.24977085A>G
                            17.

                            rs10866713 [Homo sapiens]
                              GCCCTGGGAGTGCTCACTCCATGAG[A/G]AGAGGTATAGTCAGCGGAGGAACAA
                              Chromosome:
                              5:159491886
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.1194/598
                              HGVS:
                              NC_000005.10:g.159491886G>A, NC_000005.9:g.158918894G>A
                              18.

                              rs10806425 [Homo sapiens]
                                AAGATCCTACCACGTACAGGACACA[A/C]CCCATAATAAAGTATTACTGGTCCA
                                Chromosome:
                                6:90216893
                                Gene:
                                BACH2 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.2730/1367
                                HGVS:
                                NC_000006.11:g.90926612C>A, NC_000006.12:g.90216893C>A, NM_001170794.1:c.-274-10212G>T, NM_021813.3:c.-274-10212G>T, XM_011536037.1:c.-274-10212G>T, XM_011536038.1:c.-354-10212G>T, XM_011536039.1:c.-274-10212G>T, XM_011536040.1:c.-275+1086G>T, XM_011536041.1:c.-269-10217G>T, XM_011536042.1:c.-73-10212G>T, XM_011536043.1:c.-73-10212G>T
                                19.

                                rs10758669 [Homo sapiens]
                                  TAGAGACAAGGACATGCTGAAGTAC[A/C]GAGGAGGTATTGGAAAATTTCTTTG
                                  Chromosome:
                                  9:4981602
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.3161/1583
                                  HGVS:
                                  NC_000009.11:g.4981602C>A, NC_000009.12:g.4981602C>A, NG_009904.1:g.1358C>A
                                  20.

                                  rs10499194 [Homo sapiens]
                                    AATATTGATTTTCTTCAAATGTGTT[C/T]AACCCTTTTGTTCAAAAAGTAGTCA
                                    Chromosome:
                                    6:137681500
                                    Validated:
                                    by 1000G,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    T=0.1915/959
                                    HGVS:
                                    NC_000006.11:g.138002637C>T, NC_000006.12:g.137681500C>T

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center