Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

2.

rs755622 [Homo sapiens]
    CGCTAAGCCCGGCGCACCGCTCCAA[C/G]CTGTTCTCCACTTGGCGGCTAGAAA
    Chromosome:
    22:23894205
    Gene:
    MIF-AS1 (GeneView) MIF (GeneView)
    Functional Consequence:
    nc transcript variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    C=0.2668/1336
    HGVS:
    NC_000022.10:g.24236392G>C, NC_000022.11:g.23894205G>C, NG_012099.1:g.4828G>C, NM_002415.1:c.-270G>C, NR_038911.1:n.1697C>G, NT_187633.1:g.130567G>C, XR_244371.1:n.1872C>G

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center