Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs121913059 [Homo sapiens]
    TAAACGGGGATATCGTCTTTCATCA[C/T]GTTCTCACACATTGCGAACAACATG
    Chromosome:
    1:196747245
    Gene:
    CFH (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    CM000663.2:g.196747245C>T, NC_000001.10:g.196716375C>T, NC_000001.11:g.196747245C>T, NG_007259.1:g.100235C>T, NM_000186.3:c.3628C>T, NP_000177.2:p.Arg1210Cys, XR_001737134.1:n.3851C>T
    2.

    rs35274867 [Homo sapiens]
      TTTCTATTCAGACACCTCCTGTGTG[A/T]ATCCGCCCACAGTACAAAATGCTTA
      Chromosome:
      1:196743466
      Gene:
      CFH (GeneView)
      Functional Consequence:
      missense,nc transcript variant
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.0142/71
      HGVS:
      CM000663.2:g.196743466A>T, NC_000001.10:g.196712596A>T, NC_000001.11:g.196743466A>T, NG_007259.1:g.96456A>T, NM_000186.3:c.3148A>T, NP_000177.2:p.Asn1050Tyr, XR_001737134.1:n.3371A>T
      3.

      rs10801555 [Homo sapiens]
        ctgtaccctcattatctgcctaaac[A/G]attttttctcaactcctatatcaAT
        Chromosome:
        1:196691131
        Gene:
        CFH (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        A=0.2674/1339
        HGVS:
        CM000663.2:g.196691131A>G, NC_000001.10:g.196660261A>G, NC_000001.11:g.196691131A>G, NG_007259.1:g.44121A>G, NM_000186.3:c.1336+892A>G, NM_001014975.2:c.1336+892A>G, XR_001737134.1:n.1458+892A>G
        4.

        rs10737680 [Homo sapiens]
          TCTTTGCTGCAAACCCTACTGTCTC[A/C]GCGTATTGGTCTATTGCTAAACAGT
          Chromosome:
          1:196710325
          Gene:
          CFH (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4796/2402
          HGVS:
          CM000663.2:g.196710325A>C, NC_000001.10:g.196679455A>C, NC_000001.11:g.196710325A>C, NG_007259.1:g.63315A>C, NM_000186.3:c.1337-3410A>C, XR_001737134.1:n.1459-3410A>C
          5.

          rs1410996 [Homo sapiens]
            TGACTCAGTCCCTGACTACCTCATG[C/T]CACTCAGCTATACCACTGATGTAGA
            Chromosome:
            1:196727803
            Gene:
            CFH (GeneView)
            Functional Consequence:
            intron variant
            Clinical significance:
            other
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            G=0.4950/2479
            HGVS:
            CM000663.2:g.196727803G>A, NC_000001.10:g.196696933G, NC_000001.10:g.196696933G>A, NC_000001.11:g.196727803G, NC_000001.11:g.196727803G>A, NG_007259.1:g.80793G, NG_007259.1:g.80793G>A, NM_000186.3:c.2237-543G, NM_000186.3:c.2237-543G>A, XR_001737134.1:n.2460-543G, XR_001737134.1:n.2460-543G>A
            6.

            rs1080155 [Homo sapiens]
              ATCCATTGATCTGTCATGGACAAGC[C/T]TAAGATCATACCAGGGGACTCAATG
              Chromosome:
              5:155469551
              Validated:
              no info
              HGVS:
              CM000667.2:g.155469551C>T, NC_000005.9:g.154849111C>T
              7.

              rs1065489 [Homo sapiens]
                GCCTTCCTTGTAAATCTCCACCTGA[G/T]ATTTCTCATGGTGTTGTAGCTCACA
                Chromosome:
                1:196740644
                Gene:
                CFH (GeneView)
                Functional Consequence:
                missense,nc transcript variant
                Clinical significance:
                Benign
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2033/1018
                HGVS:
                CM000663.2:g.196740644G>T, NC_000001.10:g.196709774G>T, NC_000001.11:g.196740644G>T, NG_007259.1:g.93634G>T, NM_000186.3:c.2808G>T, NP_000177.2:p.Glu936Asp, XR_001737134.1:n.3031G>T
                9.

                rs800292 [Homo sapiens]
                  TCTCCCTTCCTGCATACCATTATTA[C/T]ATTTCCAAGAGATCTATATCCAGGG
                  Chromosome:
                  1:196673103
                  Gene:
                  CFH (GeneView)
                  Functional Consequence:
                  missense,nc transcript variant
                  Allele Origin:
                  T(germline)/C(germline)
                  Clinical significance:
                  other
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  A=0.4681/2344
                  HGVS:
                  CM000663.2:g.196673103G>A, NC_000001.10:g.196642233G>A, NC_000001.11:g.196673103G>A, NG_007259.1:g.26093G>A, NM_000186.3:c.184G>A, NM_001014975.2:c.184G>A, NP_000177.2:p.Val62Ile, NP_001014975.1:p.Val62Ile, XP_005245168.1:p.Val62Ile, XP_005245169.1:p.Val62Ile, XP_016856597.1:p.Val62Ile, XR_001737134.1:n.306G>A

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center