Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs16969968 [Homo sapiens]
    TAGAAACACATTGGAAGCTGCGCTC[A/G]ATTCTATTCGCTACATTACAAGACA
    Chromosome:
    15:78590583
    Gene:
    CHRNA5 (GeneView)
    Functional Consequence:
    intron variant,missense,nc transcript variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1496/749
    HGVS:
    NC_000015.10:g.78590583G>A, NC_000015.9:g.78882925G>A, NG_023328.1:g.30064G>A, NM_000745.3:c.1192G>A, NM_001307945.1:c.458+734G>A, NP_000736.2:p.Asp398Asn, XM_005254142.1:c.707+485G>A, XM_005254142.3:c.707+485G>A, XM_017021881.1:c.713+479G>A, XR_001751067.1:n.1391G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center