Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 21

1.

rs4803455 [Homo sapiens]
    CCTGAATTCTCAGTAACTTAGAAGT[A/C]ATTTCTAATGATTCCggctgggcac
    Chromosome:
    19:41345604
    Gene:
    TGFB1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4772/2390
    HGVS:
    NC_000019.10:g.41345604C>A, NC_000019.9:g.41851509C>A, NG_013364.1:g.13323G>T, NM_000660.6:c.517-740G>T, XM_005259187.1:c.517-740G>T, XM_011527242.1:c.517-740G>T
    2.

    rs4694637 [Homo sapiens]
      acattcttataactagaaggaacag[A/G]caacacataaacaaaccattgcaat
      Chromosome:
      4:73747117
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4956/2482
      HGVS:
      NC_000004.11:g.74612834G>A, NC_000004.12:g.73747117G>A
      3.

      rs4252041 [Homo sapiens]
        ACAACCTGGTCACAGGACTCTGCCT[C/T]CTCTTCAACTGACCAGCCTCCATGC
        Chromosome:
        2:113133033
        Gene:
        IL1RN (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Clinical significance:
        Likely benign
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0188/94
        HGVS:
        NC_000002.11:g.113890610C>T, NC_000002.12:g.113133033C>T, NG_021240.1:g.20141C>T, NM_000577.4:c.*162C>T, NM_001318914.1:c.*162C>T, NM_173841.2:c.*162C>T, NM_173842.2:c.*162C>T, NM_173843.2:c.*162C>T, XM_005263661.1:c.*162C>T, XM_005263661.4:c.*162C>T, XM_005263662.1:c.*162C>T, XM_005263663.1:c.*162C>T, XM_011511121.1:c.*162C>T
        4.

        rs3181052 [Homo sapiens]
          TTTGTCTGGGCCGAGGCTGCAAGTC[A/G]GGCTCTGTGGGTGTATGAGTGACAA
          Chromosome:
          2:113128472
          Gene:
          IL1RN (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2372/1188
          HGVS:
          NC_000002.11:g.113886049G>A, NC_000002.12:g.113128472G>A, NG_021240.1:g.15580G>A, NM_000577.4:c.62+732G>A, NM_001318914.1:c.14+732G>A, NM_173841.2:c.125+732G>A, NM_173842.2:c.116+732G>A, NM_173843.2:c.14+732G>A, XM_005263661.1:c.14+732G>A, XM_005263661.4:c.14+732G>A, XM_005263662.1:c.14+732G>A, XM_005263663.1:c.14+732G>A, XM_011511121.1:c.14+732G>A
          5.

          rs2857656 [Homo sapiens]
            TTCCTTTTCTGCAGTTTTCGCTTCA[A/C/G]AGAAAGCAGAATCCTTAAAAATAAC
            Chromosome:
            17:34254988
            Gene:
            CCL2 (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.4209/2108
            HGVS:
            NC_000017.10:g.32582007G>C, NC_000017.11:g.34254988G>A, NC_000017.11:g.34254988G>C, NG_012123.1:g.4712G>A, NG_012123.1:g.4712G>C, NM_002982.3:c.-362G>A, NM_002982.3:c.-362G>C
            6.

            rs2241719 [Homo sapiens]
              CGCATTTGGGGAGTGTAAACAGGAG[A/T]GGGAGAGGAAGGCGGAGGAAGGGAA
              Chromosome:
              19:41323676
              Gene:
              CCDC97 (GeneView)
              Functional Consequence:
              utr variant 3 prime
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1460/731
              HGVS:
              NC_000019.10:g.41323676T>A, NC_000019.9:g.41829581T>A, NM_001346100.1:c.*961T>A, NM_052848.2:c.*961T>A, XM_005259377.1:c.*961T>A, XM_005259377.4:c.*961T>A
              7.

              rs2241718 [Homo sapiens]
                TCAGGACCCATGATAACAGCCTGTG[C/T]GCATTTGGGGAGTGTAAACAGGAGA
                Chromosome:
                19:41323701
                Gene:
                CCDC97 (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1450/726
                HGVS:
                NC_000019.10:g.41323701G>A, NC_000019.9:g.41829606G>A, NM_001346100.1:c.*986G>A, NM_052848.2:c.*986G>A, XM_005259377.1:c.*986G>A, XM_005259377.4:c.*986G>A
                8.

                rs2234676 [Homo sapiens]
                  CCTCTGTGAGTGTGTGGGAGGGGAG[A/G]CTGGGCTCCTCCTTGTACTCTCTGA
                  Chromosome:
                  2:113117851
                  Gene:
                  IL1RN (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  A=0.1859/931
                  HGVS:
                  NC_000002.11:g.113875428G>A, NC_000002.12:g.113117851G>A, NG_021240.1:g.4959G>A, NM_000577.4:c.-168G>A, NM_001318914.1:c.-450G>A, NM_173841.2:c.-168G>A, NM_173843.2:c.-387G>A, XM_005263662.1:c.-272-2215G>A, XM_005263663.1:c.-450G>A, XM_011511121.1:c.-272-2215G>A
                  9.

                  rs2227307 [Homo sapiens]
                    TATTCTGCTTTTATAATTTATACCA[G/T]GTAGCATGCATATATTTAACGTAAA
                    Chromosome:
                    4:73740952
                    Gene:
                    CXCL8 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    G=0.4235/2121
                    HGVS:
                    NC_000004.11:g.74606669T>G, NC_000004.12:g.73740952T>G, NG_029889.1:g.5447T>G, NM_000584.3:c.64+230T>G
                    10.

                    rs2227306 [Homo sapiens]
                      AACTCTAACTCTTTATATAGGAAGT[C/T]GTTCAATGTTGTCAGTTATGACTGT
                      Chromosome:
                      4:73741338
                      Gene:
                      CXCL8 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.2594/1299
                      HGVS:
                      NC_000004.11:g.74607055C>T, NC_000004.12:g.73741338C>T, NG_029889.1:g.5833C>T, NM_000584.3:c.65-204C>T
                      11.

                      rs1982072 [Homo sapiens]
                        CATCTTAATCCTTGGACTAGGCTTG[A/T]AAATATGGGGTGAGAATCGTAATAA
                        Chromosome:
                        19:41358604
                        Gene:
                        B9D2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.3592/1799
                        HGVS:
                        NC_000019.10:g.41358604T>A, NC_000019.9:g.41864509T>A, NG_013091.1:g.10570A>T, NG_013364.1:g.323A>T, NM_030578.3:c.89-582A>T, XM_005259150.1:c.-30+7402T>A, XM_011527349.2:c.89-582A>T, XM_011527350.1:c.-71-582A>T
                        12.

                        rs1794065 [Homo sapiens]
                          GCAGTGTGCACATCTGTCCACCCAA[A/G]CTGGATGCCAACATTTCACAAATAG
                          Chromosome:
                          2:113122156
                          Gene:
                          IL1RN (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          A=0.1857/930
                          HGVS:
                          NC_000002.11:g.113879733G>A, NC_000002.12:g.113122156G>A, NG_021240.1:g.9264G>A, NM_000577.4:c.10+4128G>A, NM_001318914.1:c.-39+538G>A, NM_173841.2:c.73+2028G>A, NM_173843.2:c.-39+538G>A, XM_005263662.1:c.-39+538G>A, XM_005263663.1:c.-39+538G>A, XM_011511121.1:c.-39+538G>A
                          13.

                          rs1080327 [Homo sapiens]
                            tttcagtctttttctattgtgtatg[A/T]ttttaactgtgggcttttcatacat
                            Chromosome:
                            17:34264647
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.4119/2063
                            HGVS:
                            NC_000017.10:g.32591666T>A, NC_000017.11:g.34264647T>A
                            16.

                            rs315951 [Homo sapiens]
                              GGAGGCAGAGTCCTGTGACCAGGTT[C/G]TTGTGACGCCTTCTGAGGGTCCACC
                              Chromosome:
                              2:113133009
                              Gene:
                              IL1RN (GeneView)
                              Functional Consequence:
                              utr variant 3 prime
                              Clinical significance:
                              Benign
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.3550/1778
                              HGVS:
                              NC_000002.11:g.113890586C>G, NC_000002.12:g.113133009C>G, NG_021240.1:g.20117C>G, NM_000577.4:c.*138C>G, NM_001318914.1:c.*138C>G, NM_173841.2:c.*138C>G, NM_173842.2:c.*138C>G, NM_173843.2:c.*138C>G, XM_005263661.1:c.*138C>G, XM_005263661.4:c.*138C>G, XM_005263662.1:c.*138C>G, XM_005263663.1:c.*138C>G, XM_011511121.1:c.*138C>G
                              17.

                              rs315946 [Homo sapiens]
                                GTAGGAGAATCCCTTTATGCTAGTG[C/T]GTATGCCAAAACTTATGCATTGTGT
                                Chromosome:
                                2:113136287
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.0421/211
                                HGVS:
                                NC_000002.11:g.113893864G>A, NC_000002.12:g.113136287G>A
                                18.

                                rs13900 [Homo sapiens]
                                  TTTCCCCTAGCTTTCCCCAGACACC[C/T]TGTTTTATTTTATTATAATGAATTT
                                  Chromosome:
                                  17:34256892
                                  Gene:
                                  CCL2 (GeneView)
                                  Functional Consequence:
                                  utr variant 3 prime
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.3632/1819
                                  HGVS:
                                  NC_000017.10:g.32583911C>T, NC_000017.11:g.34256892C>T, NG_012123.1:g.6616C>T, NM_002982.3:c.*65C>T
                                  19.

                                  rs9005 [Homo sapiens]
                                    TGTGCCTCTGCCTGTCTCCCCCACC[A/G]GGCTGGGAGCTCTGCAGAGCAGGAA
                                    Chromosome:
                                    2:113133835
                                    Gene:
                                    IL1RN (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Clinical significance:
                                    Benign
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.3199/1602
                                    HGVS:
                                    NC_000002.11:g.113891412G>A, NC_000002.12:g.113133835G>A, NG_021240.1:g.20943G>A, NM_000577.4:c.*964G>A, NM_001318914.1:c.*964G>A, NM_173841.2:c.*964G>A, NM_173842.2:c.*964G>A, NM_173843.2:c.*964G>A, XM_005263661.1:c.*964G>A, XM_005263661.4:c.*964G>A, XM_005263662.1:c.*964G>A, XM_005263663.1:c.*964G>A, XM_011511121.1:c.*964G>A
                                    20.

                                    rs4586 [Homo sapiens]
                                      CAATCAATGCCCCAGTCACCTGCTG[C/T]TATAACTTCACCAATAGGAAGATCT
                                      Chromosome:
                                      17:34256250
                                      Gene:
                                      CCL2 (GeneView)
                                      Functional Consequence:
                                      synonymous codon
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      T=0.4577/2292
                                      HGVS:
                                      NC_000017.10:g.32583269T>C, NC_000017.11:g.34256250T>C, NG_012123.1:g.5974T>C, NM_002982.3:c.105T>C, NP_002973.1:p.Cys35

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center