Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs13147758 [Homo sapiens]
    GCACATAAAATATTTAGTGTCATTC[A/G]TAGGACTGAGCATCAAGAACTCAAG
    Chromosome:
    4:144539078
    Gene:
    LOC105377462 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2885/1445
    HGVS:
    NC_000004.11:g.145460230A>G, NC_000004.12:g.144539078A>G, XR_939272.2:n.522+22906T>C, XR_939273.2:n.522+22906T>C
    2.

    rs13118928 [Homo sapiens]
      AAACAATATTCCACATTGATTGTCT[A/G]TCATTCAGTTGGTTCCAAAGTGCAA
      Chromosome:
      4:144565237
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2979/1492
      HGVS:
      NC_000004.11:g.145486389A>G, NC_000004.12:g.144565237A>G
      3.

      rs12899618 [Homo sapiens]
        CCATATTGCTTTTATGAGCCCTGAT[A/G]AAAGAAAAATGAATTCCAGCCAGAG
        Chromosome:
        15:71352781
        Gene:
        THSD4 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1350/676
        HGVS:
        NC_000015.10:g.71352781G>A, NC_000015.9:g.71645120G>A, NM_024817.2:c.1016-58906G>A, XM_005254678.1:c.1016-58906G>A, XM_006720692.3:c.1016-58906G>A, XM_011522044.2:c.7+20409G>A, XM_017022582.1:c.270+96066G>A, XM_017022583.1:c.38-58906G>A, XM_017022585.1:c.120+96066G>A, XM_017022586.1:c.-39+4291G>A
        4.

        rs12504628 [Homo sapiens]
          TGAGATTTAGAGTGCCATTACCCCA[C/T]TAAAGGTATTTATCTGGGGCTTTCA
          Chromosome:
          4:144515172
          Gene:
          LOC105377462 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3039/1522
          HGVS:
          NC_000004.11:g.145436324T>C, NC_000004.12:g.144515172T>C, XR_939272.2:n.523-15652A>G, XR_939273.2:n.522+46812A>G
          5.

          rs10516526 [Homo sapiens]
            TGGGTGGTGGACTAGAATGAACTAT[A/G]TTGAAAGATCCCTGAAGTCCATTTC
            Chromosome:
            4:105767747
            Gene:
            GSTCD (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.0317/159
            HGVS:
            NC_000004.11:g.106688904A>G, NC_000004.12:g.105767747A>G, NM_001031720.3:c.1240+38248A>G, NM_024751.3:c.979+38248A>G, XM_005263222.1:c.1240+38248A>G, XM_005263222.3:c.1240+38248A>G, XM_011532248.2:c.1240+38248A>G, XM_011532249.2:c.1240+38248A>G, XM_011532252.2:c.1240+38248A>G, XR_244687.1:n.346-14446T>C, XR_938771.1:n.1500+38248A>G
            6.

            rs3995090 [Homo sapiens]
              CAGCCTCTTCTTCCCTCCTGTAGCT[A/C]ATCTCCATGATATGTCTATGTTGAA
              Chromosome:
              5:148466252
              Gene:
              HTR4 (GeneView) LOC107986462 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.4437/2222
              HGVS:
              NC_000005.10:g.148466252A>C, NC_000005.9:g.147845815A>C, NG_029052.1:g.192925T>G, NM_001040169.2:c.1077-14980T>G, NM_199453.3:c.1077-327T>G, XR_001742935.1:n.679-2668A>C
              7.

              rs2571445 [Homo sapiens]
                CACTCCCCCTAGTCCTGGCTTCGGC[C/T]GGCGGGCCATCAATCCCAGCATGGC
                Chromosome:
                2:217818431
                Gene:
                TNS1 (GeneView)
                Functional Consequence:
                missense
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.3411/1708
                HGVS:
                NC_000002.11:g.218683154A>G, NC_000002.12:g.217818431A>G, NM_001308022.1:c.3550T>C, NM_001308023.1:c.3526T>C, NM_022648.5:c.3589T>C, NP_001294951.1:p.Trp1184Arg, NP_001294952.1:p.Trp1176Arg, NP_072174.3:p.Trp1197Arg, XM_005246821.1:c.3901T>C, XM_005246822.1:c.3808T>C, XM_005246823.1:c.3808T>C, XM_005246824.1:c.3526T>C, XM_005246825.1:c.2938T>C, XM_005246826.1:c.2440T>C, XM_005246827.1:c.2440T>C, XM_011511712.1:c.3916T>C, XM_011511713.1:c.3901T>C, XM_011511715.1:c.3877T>C, XM_011511723.2:c.3526T>C, XM_011511728.1:c.922T>C, XM_017004801.1:c.4072T>C, XM_017004802.1:c.4024T>C, XM_017004803.1:c.3985T>C, XM_017004804.1:c.3940T>C, XM_017004805.1:c.3856T>C, XM_017004806.1:c.3829T>C, XM_017004807.1:c.3790T>C, XM_017004808.1:c.3565T>C, XM_017004809.1:c.4072T>C, XM_017004810.1:c.4072T>C, XM_017004811.1:c.3808T>C, XM_017004812.1:c.3808T>C, XM_017004813.1:c.2938T>C, XM_017004814.1:c.2440T>C, XM_017004815.1:c.2440T>C, XM_017004816.1:c.1162T>C, XM_017004817.1:c.1117T>C, XP_005246878.1:p.Trp1301Arg, XP_005246879.1:p.Trp1270Arg, XP_005246880.1:p.Trp1270Arg, XP_005246881.1:p.Trp1176Arg, XP_005246882.1:p.Trp980Arg, XP_005246883.1:p.Trp814Arg, XP_005246884.1:p.Trp814Arg, XP_011510014.1:p.Trp1306Arg, XP_011510015.1:p.Trp1301Arg, XP_011510017.1:p.Trp1293Arg, XP_011510025.1:p.Trp1176Arg, XP_011510030.1:p.Trp308Arg, XP_016860290.1:p.Trp1358Arg, XP_016860291.1:p.Trp1342Arg, XP_016860292.1:p.Trp1329Arg, XP_016860293.1:p.Trp1314Arg, XP_016860294.1:p.Trp1286Arg, XP_016860295.1:p.Trp1277Arg, XP_016860296.1:p.Trp1264Arg, XP_016860297.1:p.Trp1189Arg, XP_016860298.1:p.Trp1358Arg, XP_016860299.1:p.Trp1358Arg, XP_016860300.1:p.Trp1270Arg, XP_016860301.1:p.Trp1270Arg, XP_016860302.1:p.Trp980Arg, XP_016860303.1:p.Trp814Arg, XP_016860304.1:p.Trp814Arg, XP_016860305.1:p.Trp388Arg, XP_016860306.1:p.Trp373Arg
                9.

                rs323606 [Homo sapiens]
                  tgaccaaaatggtgatagtgaaatg[A/G]acaataaagtccaggctgaggtggt
                  Chromosome:
                  18:40892423
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  A=0.0605/303
                  HGVS:
                  NC_000018.10:g.40892423G>A, NC_000018.9:g.38472387G>A

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center