Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

2.

rs4464148 [Homo sapiens]
    GGGGGAACAGACAGAGAAGGATGAA[C/T]GTGAAAAGGAAACACCCTGGTAACT
    Chromosome:
    18:48932662
    Gene:
    SMAD7 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    C=0.1595/799
    HGVS:
    CM000680.2:g.48932662T>C, NC_000018.10:g.48932662T>C, NC_000018.9:g.46459032T>C, NG_023330.1:g.23050A>G, NM_001190821.1:c.739+9819A>G, NM_001190822.1:c.97+9819A>G, NM_001190823.1:c.178+9819A>G, NM_005904.3:c.742+9819A>G

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center