Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 11

1.

rs10519177 [Homo sapiens]
    CACAAGGAGGTCTCTTTCCTAAACA[A/G]TTGTGTGATTCCTCCATGTAGATGA
    Chromosome:
    15:48464998
    Gene:
    FBN1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3878/1942
    HGVS:
    NC_000015.10:g.48464998A>G, NC_000015.9:g.48757195A>G, NG_008805.2:g.185791T>C, NM_000138.4:c.4942+570T>C
    2.

    rs9806323 [Homo sapiens]
      TGGTGAGAAATAGGCAAAAAAAAAA[A/T]AATAATAAATAAAGGCTAGGCATAT
      Chromosome:
      15:48473818
      Gene:
      FBN1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4141/2074
      HGVS:
      NC_000015.10:g.48473818T>A, NC_000015.9:g.48766015T>A, NG_008805.2:g.176971A>T, NM_000138.4:c.4210+437A>T
      3.

      rs4774517 [Homo sapiens]
        GGGTGACAACTAGTGGAGTCCTAAT[G/T]TGCACCAGGTGTGCTCTTTGTACCA
        Chromosome:
        15:48467094
        Gene:
        FBN1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3784/1895
        HGVS:
        NC_000015.10:g.48467094G>T, NC_000015.9:g.48759291G>T, NG_008805.2:g.183695C>A, NM_000138.4:c.4747+844C>A
        4.

        rs2289136 [Homo sapiens]
          GCCCTCACACCACTAGAATTTTATA[C/T]TGAAGTGGGAATTGCTCAGGATTCT
          Chromosome:
          15:48652075
          Gene:
          LOC105370809 (GeneView)
          Functional Consequence:
          downstream variant 500B
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.2101/1052
          HGVS:
          NC_000015.10:g.48652075G>A, NC_000015.9:g.48944272G>A, XR_932209.2:n.2205G>A
          5.

          rs2118181 [Homo sapiens]
            CTACAGACAATCATGACAAAATTCA[C/T]AGAGTGACCTTGATAGGTCTCTTTG
            Chromosome:
            15:48623687
            Gene:
            FBN1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.2837/1421
            HGVS:
            NC_000015.10:g.48623687T>C, NC_000015.9:g.48915884T>C, NG_008805.2:g.27102A>G, NM_000138.4:c.165-10595A>G
            6.

            rs1036477 [Homo sapiens]
              ACCAGGTAGGCCTAATCTACCTGTC[A/G]ACTCTTATCTTTACCTATACCTTCA
              Chromosome:
              15:48622729
              Gene:
              FBN1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.2943/1474
              HGVS:
              NC_000015.10:g.48622729A>G, NC_000015.9:g.48914926A>G, NG_008805.2:g.28060T>C, NM_000138.4:c.165-9637T>C
              7.

              rs1036476 [Homo sapiens]
                TCCTGGCTTCCTAGTTTCTCTCTAC[C/T]CCATTAGGACAATATGGGTAAGTAT
                Chromosome:
                15:48622578
                Gene:
                FBN1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.0573/287
                HGVS:
                NC_000015.10:g.48622578T>C, NC_000015.9:g.48914775T>C, NG_008805.2:g.28211A>G, NM_000138.4:c.165-9486A>G
                8.

                rs755251 [Homo sapiens]
                  TGGGATTAGATTTGGGACTCTAAAT[A/G]CTGTGCTAAGTAGCAAATGTTCTTT
                  Chromosome:
                  15:48519823
                  Gene:
                  FBN1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  G=0.3812/1909
                  HGVS:
                  NC_000015.10:g.48519823A>G, NC_000015.9:g.48812020A>G, NG_008805.2:g.130966T>C, NM_000138.4:c.1147+836T>C
                  9.

                  rs689304 [Homo sapiens]
                    ATCACAGGTCCTTTTTGACATGATT[C/T]ATTTTCATAAAGACATTTTATCTTT
                    Chromosome:
                    15:48630163
                    Gene:
                    FBN1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.0603/302
                    HGVS:
                    NC_000015.10:g.48630163C>T, NC_000015.9:g.48922360C>T, NG_008805.2:g.20626G>A, NM_000138.4:c.164+14443G>A
                    10.

                    rs682938 [Homo sapiens]
                      CAAAGTAATCCATATTCATAATAGA[C/T]AATGTGAAAAGTATTTTTTTTAATT
                      Chromosome:
                      15:48572170
                      Gene:
                      FBN1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.4635/2321
                      HGVS:
                      NC_000015.10:g.48572170A>G, NC_000015.9:g.48864367A>G, NG_008805.2:g.78619T>C, NM_000138.4:c.538+24113T>C
                      11.

                      rs636178 [Homo sapiens]
                        TGCATCAAACCTGTATATCAATTTG[A/G]GGCCCTTTACACTTTTCAAACCCCT
                        Chromosome:
                        15:48605085
                        Gene:
                        FBN1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.0591/296
                        HGVS:
                        NC_000015.10:g.48605085C>T, NC_000015.9:g.48897282C>T, NG_008805.2:g.45704G>A, NM_000138.4:c.347-4851G>A

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center