Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 80

1.

rs61783628 [Homo sapiens]
    AAGGGGTTCTCCTGATAGGATTGGC[C/T]CCTGCCCCACGCTGTGGCAAAGCCG
    Chromosome:
    1:28882595
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.2037/1020
    HGVS:
    NC_000001.10:g.29209107C>T, NC_000001.11:g.28882595C>T, NG_013344.1:g.505C>T, XM_005246054.1:c.851+4687G>A
    2.

    rs35579088 [Homo sapiens]
      TAGGCTTTGCAGGCTATATGGTCTG[C/T]CACAACCACTCAGCTTTGCCATTGT
      Chromosome:
      1:29077728
      Gene:
      EPB41 (GeneView)
      Functional Consequence:
      intron variant,utr variant 3 prime
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.2177/1090
      HGVS:
      NC_000001.10:g.29404240T>C, NC_000001.11:g.29077728T>C, NG_013344.1:g.195638T>C, NM_001166005.1:c.2184+12570T>C, NM_001166007.1:c.1395+12570T>C, NM_004437.3:c.1458+12570T>C, NM_203342.2:c.1515+12570T>C, NM_203343.2:c.1917+12570T>C, XM_005245753.1:c.2184+12570T>C, XM_005245754.1:c.2181+12570T>C, XM_005245755.1:c.2142+12570T>C, XM_005245756.1:c.2085+12570T>C, XM_005245757.1:c.2079+12570T>C, XM_005245758.1:c.2076+12570T>C, XM_005245759.1:c.2022+12570T>C, XM_005245760.1:c.2235+8945T>C, XM_005245761.1:c.2184+12570T>C, XM_005245762.1:c.2184+12570T>C, XM_005245763.1:c.2142+12570T>C, XM_005245764.1:c.2085+12570T>C, XM_005245765.1:c.2079+12570T>C, XM_005245768.1:c.2184+12570T>C, XM_005245769.1:c.2022+12570T>C, XM_005245770.1:c.2019+12570T>C, XM_005245771.1:c.1557+12570T>C, XM_005245772.4:c.*8434T>C, XM_005245773.4:c.*8434T>C, XM_005245774.1:c.2022+12570T>C, XM_006710434.1:c.2220+8960T>C, XM_006710439.1:c.2220+8960T>C, XM_011540956.1:c.2235+8945T>C, XM_011540957.1:c.2232+8945T>C, XM_011540958.1:c.2235+8945T>C, XM_011540959.1:c.2193+8945T>C, XM_011540960.1:c.2136+8945T>C, XM_011540961.1:c.2130+8945T>C, XM_011540962.1:c.2073+8945T>C, XM_011540963.2:c.*7113T>C, XM_011540964.1:c.1608+8945T>C, XM_017000581.1:c.2130+8945T>C, XM_017000582.1:c.2127+8945T>C, XM_017000583.1:c.2070+8945T>C, XM_017000584.1:c.2235+8945T>C, XM_017000585.1:c.2073+8945T>C, XM_017000586.1:c.2115+8960T>C, XM_017000587.1:c.*8434T>C, XM_017000588.1:c.*8434T>C, XM_017000589.1:c.1917+12570T>C, XM_017000590.1:c.1914+12570T>C, XM_017000591.1:c.*8434T>C, XM_017000592.1:c.*8434T>C, XM_017000593.1:c.1605+8945T>C, XM_017000594.1:c.1509+8945T>C, XM_017000595.1:c.1503+8945T>C, XM_017000596.1:c.1446+8945T>C, XM_017000597.1:c.1443+8945T>C, XM_017000598.1:c.*7113T>C, XM_017000599.1:c.*8434T>C, XM_017000600.1:c.*8434T>C, XM_017000601.1:c.*8434T>C, XM_017000602.1:c.*8434T>C, XM_017000603.1:c.*8434T>C, XM_017000604.1:c.*8434T>C
      3.

      rs35423185 [Homo sapiens]
        AGGCATGAGCCACCGCGCCCGGCCC[C/T]AACTATTATTTTTTTAAATGATCTT
        Chromosome:
        1:29053860
        Gene:
        EPB41 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.2169/1086
        HGVS:
        NC_000001.10:g.29380372C>T, NC_000001.11:g.29053860C>T, NG_013344.1:g.171770C>T, NM_001166005.1:c.1845+548C>T, NM_001166006.1:c.1845+548C>T, NM_001166007.1:c.1218+548C>T, NM_004437.3:c.1218+548C>T, NM_203342.2:c.1218+548C>T, NM_203343.2:c.1740+548C>T, XM_005245753.1:c.1845+548C>T, XM_005245754.1:c.1842+548C>T, XM_005245755.1:c.1845+548C>T, XM_005245756.1:c.1845+548C>T, XM_005245757.1:c.1845+548C>T, XM_005245758.1:c.1737+548C>T, XM_005245759.1:c.1845+548C>T, XM_005245760.1:c.1845+548C>T, XM_005245761.1:c.1845+548C>T, XM_005245762.1:c.1845+548C>T, XM_005245763.1:c.1845+548C>T, XM_005245764.1:c.1845+548C>T, XM_005245765.1:c.1845+548C>T, XM_005245766.1:c.1845+548C>T, XM_005245767.1:c.1845+548C>T, XM_005245768.1:c.1845+548C>T, XM_005245769.1:c.1845+548C>T, XM_005245770.1:c.1842+548C>T, XM_005245771.1:c.1218+548C>T, XM_005245772.1:c.1845+548C>T, XM_005245772.4:c.1845+548C>T, XM_005245773.1:c.1845+548C>T, XM_005245773.4:c.1845+548C>T, XM_005245774.1:c.1845+548C>T, XM_006710434.1:c.1845+548C>T, XM_006710439.1:c.1845+548C>T, XM_011540956.1:c.1845+548C>T, XM_011540957.1:c.1842+548C>T, XM_011540958.1:c.1845+548C>T, XM_011540959.1:c.1845+548C>T, XM_011540960.1:c.1845+548C>T, XM_011540961.1:c.1845+548C>T, XM_011540962.1:c.1845+548C>T, XM_011540963.2:c.1845+548C>T, XM_011540964.1:c.1218+548C>T, XM_011540965.2:c.1845+548C>T, XM_017000581.1:c.1740+548C>T, XM_017000582.1:c.1737+548C>T, XM_017000583.1:c.1842+548C>T, XM_017000584.1:c.1845+548C>T, XM_017000585.1:c.1845+548C>T, XM_017000586.1:c.1845+548C>T, XM_017000587.1:c.1842+548C>T, XM_017000588.1:c.1842+548C>T, XM_017000589.1:c.1740+548C>T, XM_017000590.1:c.1737+548C>T, XM_017000591.1:c.1845+548C>T, XM_017000592.1:c.1842+548C>T, XM_017000593.1:c.1215+548C>T, XM_017000594.1:c.1218+548C>T, XM_017000595.1:c.1218+548C>T, XM_017000596.1:c.1218+548C>T, XM_017000597.1:c.1215+548C>T, XM_017000598.1:c.1218+548C>T, XM_017000599.1:c.1218+548C>T, XM_017000600.1:c.1218+548C>T, XM_017000601.1:c.1215+548C>T, XM_017000602.1:c.1215+548C>T, XM_017000603.1:c.1218+548C>T, XM_017000604.1:c.1215+548C>T
        4.

        rs35013556 [Homo sapiens]
          CTAGTTTGATTCTCTTTACTTTCTA[C/T]TTAGTTGAAATTACTGTTATAATTC
          Chromosome:
          1:28957883
          Gene:
          EPB41 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.2224/1114
          HGVS:
          NC_000001.10:g.29284395C>T, NC_000001.11:g.28957883C>T, NG_013344.1:g.75793C>T, NM_001166005.1:c.-7-29548C>T, NM_001166006.1:c.-7-29548C>T, NM_001166007.1:c.-617-29565C>T, NM_004437.3:c.-697-29565C>T, NM_203342.2:c.-714-29548C>T, NM_203343.2:c.-7-29548C>T, XM_005245753.1:c.-7-29548C>T, XM_005245754.1:c.-7-29548C>T, XM_005245755.1:c.-7-29548C>T, XM_005245756.1:c.-7-29548C>T, XM_005245757.1:c.-7-29548C>T, XM_005245758.1:c.-7-29548C>T, XM_005245759.1:c.-7-29548C>T, XM_005245760.1:c.-7-29548C>T, XM_005245761.1:c.-7-29548C>T, XM_005245762.1:c.-7-29548C>T, XM_005245763.1:c.-7-29548C>T, XM_005245764.1:c.-7-29548C>T, XM_005245765.1:c.-7-29548C>T, XM_005245766.1:c.-7-29548C>T, XM_005245767.1:c.-7-29548C>T, XM_005245768.1:c.-7-29548C>T, XM_005245769.1:c.-7-29548C>T, XM_005245770.1:c.-7-29548C>T, XM_005245771.1:c.-617-29565C>T, XM_005245772.1:c.-7-29548C>T, XM_005245772.4:c.-7-29548C>T, XM_005245773.1:c.-7-29548C>T, XM_005245773.4:c.-7-29548C>T, XM_005245774.1:c.-7-29548C>T, XM_006710434.1:c.-7-29548C>T, XM_006710439.1:c.-7-29548C>T, XM_011540956.1:c.-7-29548C>T, XM_011540957.1:c.-7-29548C>T, XM_011540958.1:c.-7-29548C>T, XM_011540959.1:c.-7-29548C>T, XM_011540960.1:c.-7-29548C>T, XM_011540961.1:c.-7-29548C>T, XM_011540962.1:c.-7-29548C>T, XM_011540963.2:c.-7-29548C>T, XM_011540964.1:c.-617-29565C>T, XM_011540965.2:c.-7-29548C>T, XM_017000581.1:c.-7-29548C>T, XM_017000582.1:c.-7-29548C>T, XM_017000583.1:c.-7-29548C>T, XM_017000584.1:c.-7-29548C>T, XM_017000585.1:c.-7-29548C>T, XM_017000586.1:c.-7-29548C>T, XM_017000587.1:c.-7-29548C>T, XM_017000588.1:c.-7-29548C>T, XM_017000589.1:c.-7-29548C>T, XM_017000590.1:c.-7-29548C>T, XM_017000591.1:c.-7-29548C>T, XM_017000592.1:c.-7-29548C>T, XM_017000593.1:c.-617-29565C>T, XM_017000594.1:c.-617-29565C>T, XM_017000595.1:c.-617-29565C>T, XM_017000596.1:c.-617-29565C>T, XM_017000597.1:c.-617-29565C>T, XM_017000598.1:c.-617-29565C>T, XM_017000599.1:c.-617-29565C>T, XM_017000600.1:c.-617-29565C>T, XM_017000601.1:c.-617-29565C>T, XM_017000602.1:c.-617-29565C>T, XM_017000603.1:c.-617-29565C>T, XM_017000604.1:c.-617-29565C>T
          5.

          rs34474391 [Homo sapiens]
            TATTATTATACTTTAAGTTTTAGGG[C/T]ACATGTGCACAATGTGCAGGTTTGT
            Chromosome:
            1:28981929
            Gene:
            EPB41 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            C=0.2179/1091
            HGVS:
            NC_000001.10:g.29308441T>C, NC_000001.11:g.28981929T>C, NG_013344.1:g.99839T>C, NM_001166005.1:c.-7-5502T>C, NM_001166006.1:c.-7-5502T>C, NM_001166007.1:c.-617-5519T>C, NM_004437.3:c.-697-5519T>C, NM_203342.2:c.-714-5502T>C, NM_203343.2:c.-7-5502T>C, XM_005245753.1:c.-7-5502T>C, XM_005245754.1:c.-7-5502T>C, XM_005245755.1:c.-7-5502T>C, XM_005245756.1:c.-7-5502T>C, XM_005245757.1:c.-7-5502T>C, XM_005245758.1:c.-7-5502T>C, XM_005245759.1:c.-7-5502T>C, XM_005245760.1:c.-7-5502T>C, XM_005245761.1:c.-7-5502T>C, XM_005245762.1:c.-7-5502T>C, XM_005245763.1:c.-7-5502T>C, XM_005245764.1:c.-7-5502T>C, XM_005245765.1:c.-7-5502T>C, XM_005245766.1:c.-7-5502T>C, XM_005245767.1:c.-7-5502T>C, XM_005245768.1:c.-7-5502T>C, XM_005245769.1:c.-7-5502T>C, XM_005245770.1:c.-7-5502T>C, XM_005245771.1:c.-617-5519T>C, XM_005245772.1:c.-7-5502T>C, XM_005245772.4:c.-7-5502T>C, XM_005245773.1:c.-7-5502T>C, XM_005245773.4:c.-7-5502T>C, XM_005245774.1:c.-7-5502T>C, XM_006710434.1:c.-7-5502T>C, XM_006710439.1:c.-7-5502T>C, XM_011540956.1:c.-7-5502T>C, XM_011540957.1:c.-7-5502T>C, XM_011540958.1:c.-7-5502T>C, XM_011540959.1:c.-7-5502T>C, XM_011540960.1:c.-7-5502T>C, XM_011540961.1:c.-7-5502T>C, XM_011540962.1:c.-7-5502T>C, XM_011540963.2:c.-7-5502T>C, XM_011540964.1:c.-617-5519T>C, XM_011540965.2:c.-7-5502T>C, XM_017000581.1:c.-7-5502T>C, XM_017000582.1:c.-7-5502T>C, XM_017000583.1:c.-7-5502T>C, XM_017000584.1:c.-7-5502T>C, XM_017000585.1:c.-7-5502T>C, XM_017000586.1:c.-7-5502T>C, XM_017000587.1:c.-7-5502T>C, XM_017000588.1:c.-7-5502T>C, XM_017000589.1:c.-7-5502T>C, XM_017000590.1:c.-7-5502T>C, XM_017000591.1:c.-7-5502T>C, XM_017000592.1:c.-7-5502T>C, XM_017000593.1:c.-617-5519T>C, XM_017000594.1:c.-617-5519T>C, XM_017000595.1:c.-617-5519T>C, XM_017000596.1:c.-617-5519T>C, XM_017000597.1:c.-617-5519T>C, XM_017000598.1:c.-617-5519T>C, XM_017000599.1:c.-617-5519T>C, XM_017000600.1:c.-617-5519T>C, XM_017000601.1:c.-617-5519T>C, XM_017000602.1:c.-617-5519T>C, XM_017000603.1:c.-617-5519T>C, XM_017000604.1:c.-617-5519T>C
            6.

            rs17759598 [Homo sapiens]
              GTTGGTCATGTCAGTCCTCAGCTCA[C/T]GTCTACTTGGTTCTTTGTTCTTACT
              Chromosome:
              22:21767860
              Gene:
              MAPK1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.0653/327
              HGVS:
              NC_000022.10:g.22122149T>C, NC_000022.11:g.21767860T>C, NG_023054.2:g.104821A>G, NM_002745.4:c.*9+1335A>G
              7.

              rs17690326 [Homo sapiens]
                CTTTGAAAACCTCATTCCTCAAATC[C/T]ACTCCATCATGGGTGGCCTGAAGAA
                Chromosome:
                17:45843608
                Gene:
                MAPT-AS1 (GeneView) SPPL2C (GeneView)
                Functional Consequence:
                nc transcript variant,upstream variant 2KB
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.0861/431
                HGVS:
                NC_000017.10:g.43920974T>C, NC_000017.11:g.45843608T>C, NM_175882.2:c.-1299T>C, NR_024559.1:n.588A>G, NT_167251.1:g.946566G, NT_167251.1:g.946566G>A, NT_167251.2:g.944573G, NT_167251.2:g.944573G>A, NT_187663.1:g.545729T>C
                8.

                rs17115439 [Homo sapiens]
                  AGATCAAGTTTCAGCACATCGTGTC[C/T]ATCTACGGGGTGTGCAAGCAGCCCC
                  Chromosome:
                  11:113393550
                  Gene:
                  ANKK1 (GeneView)
                  Functional Consequence:
                  synonymous codon
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.4740/2374
                  HGVS:
                  NC_000011.10:g.113393550T>C, NC_000011.9:g.113264272T>C, NG_012976.1:g.10760T>C, NM_178510.1:c.255T>C, NP_848605.1:p.Ser85, XM_011542736.2:c.255T>C, XM_011542737.2:c.255T>C, XM_011542738.2:c.33T>C, XM_017017475.1:c.255T>C, XP_011541038.1:p.Ser85, XP_011541039.1:p.Ser85, XP_011541040.1:p.Ser11, XP_016872964.1:p.Ser85
                  9.

                  rs16969968 [Homo sapiens]
                    TAGAAACACATTGGAAGCTGCGCTC[A/G]ATTCTATTCGCTACATTACAAGACA
                    Chromosome:
                    15:78590583
                    Gene:
                    CHRNA5 (GeneView)
                    Functional Consequence:
                    intron variant,missense,nc transcript variant
                    Allele Origin:
                    G(germline)/A(germline)
                    Clinical significance:
                    other
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1496/749
                    HGVS:
                    NC_000015.10:g.78590583G>A, NC_000015.9:g.78882925G>A, NG_023328.1:g.30064G>A, NM_000745.3:c.1192G>A, NM_001307945.1:c.458+734G>A, NP_000736.2:p.Asp398Asn, XM_005254142.1:c.707+485G>A, XM_005254142.3:c.707+485G>A, XM_017021881.1:c.713+479G>A, XR_001751067.1:n.1391G>A
                    10.

                    rs16837840 [Homo sapiens]
                      GGTCCTTACTGTTCTTTTCAGTTTT[A/C]CATCTCTCCTCTTTGCCTCTGTGCT
                      Chromosome:
                      1:29008768
                      Gene:
                      EPB41 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.1815/909
                      HGVS:
                      NC_000001.10:g.29335280A>C, NC_000001.11:g.29008768A>C, NG_013344.1:g.126678A>C, NM_001166005.1:c.787-3097A>C, NM_001166006.1:c.787-3097A>C, NM_001166007.1:c.160-3097A>C, NM_004437.3:c.160-3097A>C, NM_203342.2:c.160-3097A>C, NM_203343.2:c.682-3097A>C, XM_005245753.1:c.787-3097A>C, XM_005245754.1:c.787-3097A>C, XM_005245755.1:c.787-3097A>C, XM_005245756.1:c.787-3097A>C, XM_005245757.1:c.787-3097A>C, XM_005245758.1:c.682-3097A>C, XM_005245759.1:c.787-3097A>C, XM_005245760.1:c.787-3097A>C, XM_005245761.1:c.787-3097A>C, XM_005245762.1:c.787-3097A>C, XM_005245763.1:c.787-3097A>C, XM_005245764.1:c.787-3097A>C, XM_005245765.1:c.787-3097A>C, XM_005245766.1:c.787-3097A>C, XM_005245767.1:c.787-3097A>C, XM_005245768.1:c.787-3097A>C, XM_005245769.1:c.787-3097A>C, XM_005245770.1:c.787-3097A>C, XM_005245771.1:c.160-3097A>C, XM_005245772.1:c.787-3097A>C, XM_005245772.4:c.787-3097A>C, XM_005245773.1:c.787-3097A>C, XM_005245773.4:c.787-3097A>C, XM_005245774.1:c.787-3097A>C, XM_006710434.1:c.787-3097A>C, XM_006710439.1:c.787-3097A>C, XM_011540956.1:c.787-3097A>C, XM_011540957.1:c.787-3097A>C, XM_011540958.1:c.787-3097A>C, XM_011540959.1:c.787-3097A>C, XM_011540960.1:c.787-3097A>C, XM_011540961.1:c.787-3097A>C, XM_011540962.1:c.787-3097A>C, XM_011540963.2:c.787-3097A>C, XM_011540964.1:c.160-3097A>C, XM_011540965.2:c.787-3097A>C, XM_017000581.1:c.682-3097A>C, XM_017000582.1:c.682-3097A>C, XM_017000583.1:c.787-3097A>C, XM_017000584.1:c.787-3097A>C, XM_017000585.1:c.787-3097A>C, XM_017000586.1:c.787-3097A>C, XM_017000587.1:c.787-3097A>C, XM_017000588.1:c.787-3097A>C, XM_017000589.1:c.682-3097A>C, XM_017000590.1:c.682-3097A>C, XM_017000591.1:c.787-3097A>C, XM_017000592.1:c.787-3097A>C, XM_017000593.1:c.160-3097A>C, XM_017000594.1:c.160-3097A>C, XM_017000595.1:c.160-3097A>C, XM_017000596.1:c.160-3097A>C, XM_017000597.1:c.160-3097A>C, XM_017000598.1:c.160-3097A>C, XM_017000599.1:c.160-3097A>C, XM_017000600.1:c.160-3097A>C, XM_017000601.1:c.160-3097A>C, XM_017000602.1:c.160-3097A>C, XM_017000603.1:c.160-3097A>C, XM_017000604.1:c.160-3097A>C
                      11.

                      rs12914385 [Homo sapiens]
                        ACACAAGTAACTGAATTAACACACA[C/T]GCAGATAACAGCAACTACAAAAATA
                        Chromosome:
                        15:78606381
                        Gene:
                        CHRNA3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.2540/1272
                        HGVS:
                        NC_000015.10:g.78606381C>T, NC_000015.9:g.78898723C>T, NG_016143.1:g.19915G>A, NM_000743.4:c.378-4117G>A, NM_001166694.1:c.378-4117G>A, NR_046313.1:n.879-4117G>A, XM_006720382.2:c.177-4117G>A
                        12.

                        rs12734106 [Homo sapiens]
                          cgctcttgttgcccaggctggagtg[C/T]cgtggcgcgatctcggctcactgca
                          Chromosome:
                          1:29036314
                          Gene:
                          EPB41 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          T=0.2109/1056
                          HGVS:
                          NC_000001.10:g.29362826C>T, NC_000001.11:g.29036314C>T, NG_013344.1:g.154224C>T, NM_001166005.1:c.1463+391C>T, NM_001166006.1:c.1463+391C>T, NM_001166007.1:c.836+391C>T, NM_004437.3:c.836+391C>T, NM_203342.2:c.836+391C>T, NM_203343.2:c.1358+391C>T, XM_005245753.1:c.1463+391C>T, XM_005245754.1:c.1463+391C>T, XM_005245755.1:c.1463+391C>T, XM_005245756.1:c.1463+391C>T, XM_005245757.1:c.1463+391C>T, XM_005245758.1:c.1358+391C>T, XM_005245759.1:c.1463+391C>T, XM_005245760.1:c.1463+391C>T, XM_005245761.1:c.1463+391C>T, XM_005245762.1:c.1463+391C>T, XM_005245763.1:c.1463+391C>T, XM_005245764.1:c.1463+391C>T, XM_005245765.1:c.1463+391C>T, XM_005245766.1:c.1463+391C>T, XM_005245767.1:c.1463+391C>T, XM_005245768.1:c.1463+391C>T, XM_005245769.1:c.1463+391C>T, XM_005245770.1:c.1463+391C>T, XM_005245771.1:c.836+391C>T, XM_005245772.1:c.1463+391C>T, XM_005245772.4:c.1463+391C>T, XM_005245773.1:c.1463+391C>T, XM_005245773.4:c.1463+391C>T, XM_005245774.1:c.1463+391C>T, XM_006710434.1:c.1463+391C>T, XM_006710439.1:c.1463+391C>T, XM_011540956.1:c.1463+391C>T, XM_011540957.1:c.1463+391C>T, XM_011540958.1:c.1463+391C>T, XM_011540959.1:c.1463+391C>T, XM_011540960.1:c.1463+391C>T, XM_011540961.1:c.1463+391C>T, XM_011540962.1:c.1463+391C>T, XM_011540963.2:c.1463+391C>T, XM_011540964.1:c.836+391C>T, XM_011540965.2:c.1463+391C>T, XM_017000581.1:c.1358+391C>T, XM_017000582.1:c.1358+391C>T, XM_017000583.1:c.1463+391C>T, XM_017000584.1:c.1463+391C>T, XM_017000585.1:c.1463+391C>T, XM_017000586.1:c.1463+391C>T, XM_017000587.1:c.1463+391C>T, XM_017000588.1:c.1463+391C>T, XM_017000589.1:c.1358+391C>T, XM_017000590.1:c.1358+391C>T, XM_017000591.1:c.1463+391C>T, XM_017000592.1:c.1463+391C>T, XM_017000593.1:c.836+391C>T, XM_017000594.1:c.836+391C>T, XM_017000595.1:c.836+391C>T, XM_017000596.1:c.836+391C>T, XM_017000597.1:c.836+391C>T, XM_017000598.1:c.836+391C>T, XM_017000599.1:c.836+391C>T, XM_017000600.1:c.836+391C>T, XM_017000601.1:c.836+391C>T, XM_017000602.1:c.836+391C>T, XM_017000603.1:c.836+391C>T, XM_017000604.1:c.836+391C>T
                          13.

                          rs12441354 [Homo sapiens]
                            aaaaactagctgggcatggtgacgc[A/G]tgcctgtaatctcagctactcagag
                            Chromosome:
                            15:78528674
                            Gene:
                            HYKK (GeneView)
                            Functional Consequence:
                            downstream variant 500B,intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.3652/1829
                            HGVS:
                            NC_000015.10:g.78528674G>A, NC_000015.9:g.78821016G>A, NM_001013619.3:c.661+1111G>A, NM_001083612.1:c.661+1111G>A, XM_017021922.1:c.*487G>A, XR_243078.1:n.2053G>A, XR_243078.4:n.942+1111G>A
                            14.

                            rs12404612 [Homo sapiens]
                              TTTTTTTGAGACAGAGCTTCGCTTT[C/T]ATCGCTCAGGCTGAAGTGCAATGGC
                              Chromosome:
                              1:28858581
                              Gene:
                              OPRD1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.1835/919
                              HGVS:
                              NC_000001.10:g.29185093T>C, NC_000001.11:g.28858581T>C, NM_000911.3:c.228-373T>C
                              15.

                              rs12039988 [Homo sapiens]
                                gaaGAGATTACTGGTGAGCCACTAC[A/G]CCTGGCCAAAttttcttttctgaga
                                Chromosome:
                                1:29099321
                                Gene:
                                EPB41 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.2187/1095
                                HGVS:
                                NC_000001.10:g.29425833G>A, NC_000001.11:g.29099321G>A, NG_013344.1:g.217231G>A, NM_001166005.1:c.2313+1386G>A, NM_001166007.1:c.1524+1386G>A, NM_004437.3:c.1587+1386G>A, NM_203342.2:c.1644+1386G>A, NM_203343.2:c.2046+1386G>A, XM_005245753.1:c.2763+1386G>A, XM_005245754.1:c.2760+1386G>A, XM_005245755.1:c.2721+1386G>A, XM_005245756.1:c.2664+1386G>A, XM_005245757.1:c.2658+1386G>A, XM_005245758.1:c.2655+1386G>A, XM_005245759.1:c.2601+1386G>A, XM_005245760.1:c.2364+1386G>A, XM_005245761.1:c.2313+1386G>A, XM_005245762.1:c.2763+1386G>A, XM_005245763.1:c.2271+1386G>A, XM_005245764.1:c.2214+1386G>A, XM_005245765.1:c.2208+1386G>A, XM_005245768.1:c.2185-10015G>A, XM_005245769.1:c.2151+1386G>A, XM_005245770.1:c.2148+1386G>A, XM_005245771.1:c.2136+1386G>A, XM_005245774.1:c.2023-10015G>A, XM_006710434.1:c.2799+1386G>A, XM_006710439.1:c.2349+1386G>A, XM_011540956.1:c.2814+1386G>A, XM_011540957.1:c.2811+1386G>A, XM_011540958.1:c.2775+1386G>A, XM_011540959.1:c.2772+1386G>A, XM_011540960.1:c.2715+1386G>A, XM_011540961.1:c.2709+1386G>A, XM_011540962.1:c.2652+1386G>A, XM_011540964.1:c.2187+1386G>A, XM_017000581.1:c.2709+1386G>A, XM_017000582.1:c.2706+1386G>A, XM_017000583.1:c.2649+1386G>A, XM_017000584.1:c.2814+1386G>A, XM_017000585.1:c.2652+1386G>A, XM_017000586.1:c.2244+1386G>A, XM_017000589.1:c.2046+1386G>A, XM_017000590.1:c.2043+1386G>A, XM_017000593.1:c.2184+1386G>A, XM_017000594.1:c.2088+1386G>A, XM_017000595.1:c.2082+1386G>A, XM_017000596.1:c.2025+1386G>A, XM_017000597.1:c.2022+1386G>A
                                16.

                                rs12027267 [Homo sapiens]
                                  GGGGACAATTTACTCCAGTTGAGAA[A/C]CACTGCCCTAAACATATTAGAGAAT
                                  Chromosome:
                                  1:29052363
                                  Gene:
                                  EPB41 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  A=0.2155/1079
                                  HGVS:
                                  NC_000001.10:g.29378875C>A, NC_000001.11:g.29052363C>A, NG_013344.1:g.170273C>A, NM_001166005.1:c.1637-741C>A, NM_001166006.1:c.1637-741C>A, NM_001166007.1:c.1010-741C>A, NM_004437.3:c.1010-741C>A, NM_203342.2:c.1010-741C>A, NM_203343.2:c.1532-741C>A, XM_005245753.1:c.1637-741C>A, XM_005245754.1:c.1637-744C>A, XM_005245755.1:c.1637-741C>A, XM_005245756.1:c.1637-741C>A, XM_005245757.1:c.1637-741C>A, XM_005245758.1:c.1532-744C>A, XM_005245759.1:c.1637-741C>A, XM_005245760.1:c.1637-741C>A, XM_005245761.1:c.1637-741C>A, XM_005245762.1:c.1637-741C>A, XM_005245763.1:c.1637-741C>A, XM_005245764.1:c.1637-741C>A, XM_005245765.1:c.1637-741C>A, XM_005245766.1:c.1637-741C>A, XM_005245767.1:c.1637-741C>A, XM_005245768.1:c.1637-741C>A, XM_005245769.1:c.1637-741C>A, XM_005245770.1:c.1637-744C>A, XM_005245771.1:c.1010-741C>A, XM_005245772.1:c.1637-741C>A, XM_005245772.4:c.1637-741C>A, XM_005245773.1:c.1637-741C>A, XM_005245773.4:c.1637-741C>A, XM_005245774.1:c.1637-741C>A, XM_006710434.1:c.1637-741C>A, XM_006710439.1:c.1637-741C>A, XM_011540956.1:c.1637-741C>A, XM_011540957.1:c.1637-744C>A, XM_011540958.1:c.1637-741C>A, XM_011540959.1:c.1637-741C>A, XM_011540960.1:c.1637-741C>A, XM_011540961.1:c.1637-741C>A, XM_011540962.1:c.1637-741C>A, XM_011540963.2:c.1637-741C>A, XM_011540964.1:c.1010-741C>A, XM_011540965.2:c.1637-741C>A, XM_017000581.1:c.1532-741C>A, XM_017000582.1:c.1532-744C>A, XM_017000583.1:c.1637-744C>A, XM_017000584.1:c.1637-741C>A, XM_017000585.1:c.1637-741C>A, XM_017000586.1:c.1637-741C>A, XM_017000587.1:c.1637-744C>A, XM_017000588.1:c.1637-744C>A, XM_017000589.1:c.1532-741C>A, XM_017000590.1:c.1532-744C>A, XM_017000591.1:c.1637-741C>A, XM_017000592.1:c.1637-744C>A, XM_017000593.1:c.1010-744C>A, XM_017000594.1:c.1010-741C>A, XM_017000595.1:c.1010-741C>A, XM_017000596.1:c.1010-741C>A, XM_017000597.1:c.1010-744C>A, XM_017000598.1:c.1010-741C>A, XM_017000599.1:c.1010-741C>A, XM_017000600.1:c.1010-741C>A, XM_017000601.1:c.1010-744C>A, XM_017000602.1:c.1010-744C>A, XM_017000603.1:c.1010-741C>A, XM_017000604.1:c.1010-744C>A
                                  17.

                                  rs12021667 [Homo sapiens]
                                    aatgaatcaatTAGTATCATGCATT[C/T]GAAGTAAATTTACTTGAATAAATTT
                                    Chromosome:
                                    1:28984562
                                    Gene:
                                    EPB41 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    C=0.2181/1092
                                    HGVS:
                                    NC_000001.10:g.29311074T>C, NC_000001.11:g.28984562T>C, NG_013344.1:g.102472T>C, NM_001166005.1:c.-7-2869T>C, NM_001166006.1:c.-7-2869T>C, NM_001166007.1:c.-617-2886T>C, NM_004437.3:c.-697-2886T>C, NM_203342.2:c.-714-2869T>C, NM_203343.2:c.-7-2869T>C, XM_005245753.1:c.-7-2869T>C, XM_005245754.1:c.-7-2869T>C, XM_005245755.1:c.-7-2869T>C, XM_005245756.1:c.-7-2869T>C, XM_005245757.1:c.-7-2869T>C, XM_005245758.1:c.-7-2869T>C, XM_005245759.1:c.-7-2869T>C, XM_005245760.1:c.-7-2869T>C, XM_005245761.1:c.-7-2869T>C, XM_005245762.1:c.-7-2869T>C, XM_005245763.1:c.-7-2869T>C, XM_005245764.1:c.-7-2869T>C, XM_005245765.1:c.-7-2869T>C, XM_005245766.1:c.-7-2869T>C, XM_005245767.1:c.-7-2869T>C, XM_005245768.1:c.-7-2869T>C, XM_005245769.1:c.-7-2869T>C, XM_005245770.1:c.-7-2869T>C, XM_005245771.1:c.-617-2886T>C, XM_005245772.1:c.-7-2869T>C, XM_005245772.4:c.-7-2869T>C, XM_005245773.1:c.-7-2869T>C, XM_005245773.4:c.-7-2869T>C, XM_005245774.1:c.-7-2869T>C, XM_006710434.1:c.-7-2869T>C, XM_006710439.1:c.-7-2869T>C, XM_011540956.1:c.-7-2869T>C, XM_011540957.1:c.-7-2869T>C, XM_011540958.1:c.-7-2869T>C, XM_011540959.1:c.-7-2869T>C, XM_011540960.1:c.-7-2869T>C, XM_011540961.1:c.-7-2869T>C, XM_011540962.1:c.-7-2869T>C, XM_011540963.2:c.-7-2869T>C, XM_011540964.1:c.-617-2886T>C, XM_011540965.2:c.-7-2869T>C, XM_017000581.1:c.-7-2869T>C, XM_017000582.1:c.-7-2869T>C, XM_017000583.1:c.-7-2869T>C, XM_017000584.1:c.-7-2869T>C, XM_017000585.1:c.-7-2869T>C, XM_017000586.1:c.-7-2869T>C, XM_017000587.1:c.-7-2869T>C, XM_017000588.1:c.-7-2869T>C, XM_017000589.1:c.-7-2869T>C, XM_017000590.1:c.-7-2869T>C, XM_017000591.1:c.-7-2869T>C, XM_017000592.1:c.-7-2869T>C, XM_017000593.1:c.-617-2886T>C, XM_017000594.1:c.-617-2886T>C, XM_017000595.1:c.-617-2886T>C, XM_017000596.1:c.-617-2886T>C, XM_017000597.1:c.-617-2886T>C, XM_017000598.1:c.-617-2886T>C, XM_017000599.1:c.-617-2886T>C, XM_017000600.1:c.-617-2886T>C, XM_017000601.1:c.-617-2886T>C, XM_017000602.1:c.-617-2886T>C, XM_017000603.1:c.-617-2886T>C, XM_017000604.1:c.-617-2886T>C
                                    18.

                                    rs11954565 [Homo sapiens]
                                      ACTGGCAGATAGACCTCAGACAAGT[A/G]ATTTTACTCCTGTAAGCCTGAATTT
                                      Chromosome:
                                      5:175422904
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      G=0.4101/2054
                                      HGVS:
                                      NC_000005.10:g.175422904A>G, NC_000005.9:g.174849907A>G
                                      19.

                                      rs11704205 [Homo sapiens]
                                        caaaaataaataagtaaatcagcca[C/T]gagcagtagcacgtgcctgtagtct
                                        Chromosome:
                                        22:21790964
                                        Gene:
                                        MAPK1 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        T=0.4617/2312
                                        HGVS:
                                        NC_000022.10:g.22145253T>C, NC_000022.11:g.21790964T>C, NG_023054.2:g.81717A>G, NM_002745.4:c.610-2156A>G, NM_138957.3:c.610-2156A>G
                                        20.

                                        rs11575553 [Homo sapiens]
                                          TATTTTCCAGGGCAATCAATGTTCA[C/T]GCAACTTGAAATTATATCTGTGGTC
                                          Chromosome:
                                          7:50458521
                                          Gene:
                                          DDC (GeneView)
                                          Functional Consequence:
                                          utr variant 3 prime
                                          Validated:
                                          by 1000G,by cluster,by frequency,by hapmap
                                          Global MAF:
                                          A=0.0769/385
                                          HGVS:
                                          NC_000007.13:g.50526219G>A, NC_000007.14:g.50458521G>A, NG_008742.1:g.111936C>T, NM_000790.3:c.*341C>T, NM_001082971.1:c.*341C>T, NM_001242886.1:c.*341C>T, NM_001242887.1:c.*341C>T, NM_001242888.1:c.*341C>T, NM_001242889.1:c.*341C>T, XM_005271744.1:c.*341C>T, XM_005271745.1:c.*341C>T, XM_005271745.4:c.*341C>T, XM_011515161.2:c.*341C>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center