Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 18

1.

rs16929496 [Homo sapiens]
    GAAAGAAACAGAAAACTATGAGTAG[C/T]AGTGGTTTAAGCTGTAAAAACATTT
    Chromosome:
    12:25840870
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1909/956
    HGVS:
    NC_000012.11:g.25993804T>C, NC_000012.12:g.25840870T>C
    3.

    rs11214966 [Homo sapiens]
      CACAACCCCAGTCACTTCCATATTA[C/T]GTGACCTTTATTACAAGAAAGGAAT
      Chromosome:
      11:114360533
      Gene:
      LOC101928940 (GeneView)
      Functional Consequence:
      downstream variant 500B
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1298/650
      HGVS:
      NC_000011.10:g.114360533T>C, NC_000011.9:g.114231255T>C, NR_120567.1:n.3933A>G, XR_246480.1:n.3933A>G
      5.

      rs10173081 [Homo sapiens]
        GTGAAAGAAGTCGAAGTGGGAACAG[C/T]GGTGCCCTTCTGGTTGGGTTTCTTG
        Chromosome:
        2:102340888
        Gene:
        IL1RL1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1597/800
        HGVS:
        NC_000002.11:g.102957348C>T, NC_000002.12:g.102340888C>T, NM_001282408.1:c.259+60C>T, NM_003856.3:c.610+60C>T, NM_016232.4:c.610+60C>T, NR_104167.1:n.847+60C>T, XM_006712839.3:c.610+60C>T, XM_011512151.1:c.610+60C>T
        6.

        rs10064618 [Homo sapiens]
          TAGGATATCTCCAACTATGAGATAC[A/G]GGAGACAGAAAGTATCCAACCAGGA
          Chromosome:
          5:154392729
          Gene:
          GALNT10 (GeneView) SAP30L-AS1 (GeneView)
          Functional Consequence:
          intron variant,nc transcript variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3982/1994
          HGVS:
          NC_000005.10:g.154392729G>A, NC_000005.9:g.153772289G>A, NM_198321.3:c.1056+6299G>A, NR_037897.1:n.490C>T, XM_005268478.1:c.1050+6299G>A
          7.

          rs9891949 [Homo sapiens]
            aacgaaacaaaacaaaacaaaaCAA[A/G]ATGTCTATGTATATTAATGCAATTG
            Chromosome:
            17:8195865
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3760/1883
            HGVS:
            NC_000017.10:g.8099183G>A, NC_000017.11:g.8195865G>A
            8.

            rs4845783 [Homo sapiens]
              TTGAGAAAGAGGAAGCAACTGGGGT[A/G]TCTCTGAGGTTTTGTGCCTTGTGCC
              Chromosome:
              1:152520083
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1903/953
              HGVS:
              NC_000001.10:g.152492559G>A, NC_000001.11:g.152520083G>A
              9.

              rs4653433 [Homo sapiens]
                AGTACATGTATTCTTTTGTTTGTTG[A/G]TTGGTTGGTTGATTGCTTTTTTTTT
                Chromosome:
                1:225786829
                Gene:
                SRP9 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.3800/1903
                HGVS:
                NC_000001.10:g.225974531A>G, NC_000001.11:g.225786829A>G, NM_001130440.1:c.142-33A>G, NM_003133.5:c.142-2411A>G
                10.

                rs3771180 [Homo sapiens]
                  TATGACTTGTTCAAAAATGCTGGTG[A/C]ATCATGTACTAAGAATTCTTGATGT
                  Chromosome:
                  2:102337157
                  Gene:
                  IL1RL1 (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.1597/800
                  HGVS:
                  NC_000002.11:g.102953617G>T, NC_000002.12:g.102337157G>T, NM_001282408.1:c.-146-1824G>T, NM_003856.3:c.-330G>T, NM_016232.4:c.-149-959G>T, NR_104167.1:n.-93G>T, XM_006712839.3:c.-330G>T, XM_011512151.1:c.-149-959G>T
                  11.

                  rs2894194 [Homo sapiens]
                    gatagatagataatagagacagaga[C/G/T]agatgatagatagatagagacagac
                    Chromosome:
                    7:98815672
                    Validated:
                    by 1000G,by frequency
                    Global MAF:
                    C=0.0224/112
                    HGVS:
                    NC_000007.13:g.98413295T>C, NC_000007.13:g.98413295T>G, NC_000007.14:g.98815672T>C, NC_000007.14:g.98815672T>G, NW_003571041.1:g.184854T>C, NW_003571041.1:g.184854T>G
                    12.

                    rs2453626 [Homo sapiens]
                      GGCAGGATGAGATTAGGACCTGAAC[C/T]GAACACTACCTTTCTGCAGGAATGA
                      Chromosome:
                      8:100125669
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.3700/1853
                      HGVS:
                      NC_000008.10:g.101137897T>C, NC_000008.11:g.100125669T>C
                      13.

                      rs2381416 [Homo sapiens]
                        ATGGAGGAAAGAAACAATGGACTTA[A/C]AAGTCAATAGAAATTATCTGATTTG
                        Chromosome:
                        9:6193455
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.2987/1496
                        HGVS:
                        NC_000009.11:g.6193455C>A, NC_000009.12:g.6193455C>A
                        14.

                        rs2017908 [Homo sapiens]
                          GGCTTGGCCTCACCTCTATCCCATA[G/T]CCTGGGTTGAGTGGTGCTTGGCATA
                          Chromosome:
                          3:187700180
                          Gene:
                          RTP2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.1558/780
                          HGVS:
                          NC_000003.11:g.187417968C>A, NC_000003.12:g.187700180C>A, NM_001004312.2:c.165-1169G>T, XM_017006301.1:c.165-1169G>T, XM_017006302.1:c.165-1169G>T
                          15.

                          rs1837253 [Homo sapiens]
                            AAAAGATCCTTTTATACATAAACAA[C/T]GTGTCTAAACTATGAAGCAAATTAC
                            Chromosome:
                            5:111066174
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            T=0.3822/1914
                            HGVS:
                            NC_000005.10:g.111066174T>C, NC_000005.9:g.110401872T>C
                            16.
                            17.
                            18.

                            rs335016 [Homo sapiens]
                              TGAAGCACCCTCTGCCGAGCCTCTG[A/C]GTGGCTGCCCCGAAGCCTGGGTGCA
                              Chromosome:
                              19:29882485
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              A=0.4407/2207
                              HGVS:
                              NC_000019.10:g.29882485C>A, NC_000019.9:g.30373392C>A

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center