Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 6

1.

rs10941679 [Homo sapiens]
    AAATGTGGGATGCTTTTTATTGACT[A/G]TGGAAAGAACACAGCATAAAAAAAG
    Chromosome:
    5:44706396
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3161/1583
    HGVS:
    NC_000005.10:g.44706396A>G, NC_000005.9:g.44706498A>G
    2.

    rs4866929 [Homo sapiens]
      ATATTTTTAGTTCTATTTCAATGCT[A/G]TCTAGAATTTTTATCATTGCTTTTT
      Chromosome:
      5:45266487
      Gene:
      HCN1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2658/1331
      HGVS:
      NC_000005.10:g.45266487A>G, NC_000005.9:g.45266589A>G, NG_042183.1:g.434632T>C, NM_021072.3:c.1783+602T>C
      3.

      rs4415084 [Homo sapiens]
        TGTTGTATTCCTGATGACTTGAGCA[C/T]CCAAGGGAGTGATACATACAGCACT
        Chromosome:
        5:44662413
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4645/2326
        HGVS:
        NC_000005.10:g.44662413C>T, NC_000005.9:g.44662515C>T
        5.

        rs981782 [Homo sapiens]
          TTTTCAGATAACAATCTTGAAATTT[G/T]TCTCAGGGACCATGAAAATGAATAA
          Chromosome:
          5:45285616
          Gene:
          HCN1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2696/1350
          HGVS:
          NC_000005.10:g.45285616A>C, NC_000005.9:g.45285718A>C, NG_042183.1:g.415503T>G, NM_021072.3:c.1618+17983T>G
          6.

          rs198782 [Homo sapiens]
            TCCTGGGTTCAAGCAATTCTCCTGC[C/T]TCATCCTCCCGAGTAGCTGGGATTA
            Chromosome:
            X:38802863
            Gene:
            MID1IP1-AS1 (GeneView) MID1IP1 (GeneView)
            Functional Consequence:
            intron variant,utr variant 5 prime
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            T=0.3372/1273
            HGVS:
            NC_000023.10:g.38662116T>C, NC_000023.11:g.38802863T>C, NM_001098790.1:c.-369+1376T>C, NM_001098791.1:c.-265+1376T>C, NM_021242.5:c.-1815T>C, NR_046706.1:n.151+870A>G, XM_005272629.1:c.-1815T>C

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center