Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

2.

rs855791 [Homo sapiens]
    ATCCCACAGGACCTGTGCAGCGAGG[A/C/T]CTATCGCTACCAGGTGACGCCACGC
    Chromosome:
    22:37066896
    Gene:
    TMPRSS6 (GeneView)
    Functional Consequence:
    missense
    Clinical significance:
    Benign
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    A=0.3954/1980
    HGVS:
    NC_000022.10:g.37462936A>G, NC_000022.11:g.37066896A>G, NG_012856.2:g.47668T>C, NM_001289000.1:c.2246T>C, NM_001289001.1:c.2180T>C, NM_153609.3:c.2207T>C, NP_001275929.1:p.Val749Ala, NP_001275930.1:p.Val727Ala, NP_705837.1:p.Val736Ala, XM_005261382.1:c.2273T>C, XM_011529989.2:c.1814T>C, XP_005261439.1:p.Val758Ala, XP_011528291.1:p.Val605Ala

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center