Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 20

1.

rs11569720 [Homo sapiens]
    GAAGAAGTTTCCTTGTGTCCTTCCC[A/G]TTTTAGGGTCTGTGACCTGAACCCC
    Chromosome:
    22:19961690
    Gene:
    COMT (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0052/26
    HGVS:
    NC_000022.10:g.19949213G>A, NC_000022.11:g.19961690G>A, NG_011526.1:g.24951G>A, NM_000754.3:c.-1+401G>A, NM_001135161.1:c.-1+401G>A, NM_001135162.1:c.-1+401G>A, NM_007310.2:c.-987G>A, XM_005261229.1:c.-295+401G>A, XM_011529886.1:c.114+401G>A, XM_017028594.1:c.-295+401G>A, XM_017028595.1:c.-295+401G>A
    2.

    rs11569715 [Homo sapiens]
      CACAGAAATAACATCTGCTTTGCTG[C/G]CGAGCTCAKAGGAGACCCCAGACCC
      Chromosome:
      22:19961219
      Gene:
      COMT (GeneView)
      Functional Consequence:
      missense,upstream variant 2KB,utr variant 5 prime
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.0084/42
      HGVS:
      NC_000022.10:g.19948742C>G, NC_000022.11:g.19961219C>G, NG_011526.1:g.24480C>G, NM_000754.3:c.-71C>G, NM_001135161.1:c.-71C>G, NM_001135162.1:c.-71C>G, NM_007310.2:c.-1458C>G, XM_005261229.1:c.-365C>G, XM_011529886.1:c.44C>G, XM_017028594.1:c.-365C>G, XM_017028595.1:c.-365C>G, XP_011528188.1:p.Ala15Gly
      4.

      rs5993883 [Homo sapiens]
        gttgaaagttactgaaaacatcttg[G/T]aagcttttttaggccaatatattat
        Chromosome:
        22:19950115
        Gene:
        COMT (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4756/2382
        HGVS:
        NC_000022.10:g.19937638T>G, NC_000022.11:g.19950115T>G, NG_011526.1:g.13376T>G, NM_000754.3:c.-92+8218T>G, NM_001135161.1:c.-1029T>G, NM_001135162.1:c.-1631T>G, XM_005261229.1:c.-386+8218T>G, XM_017028594.1:c.-386+8218T>G, XM_017028595.1:c.-386+7940T>G
        6.

        rs4646316 [Homo sapiens]
          CCCAGACCAGACACCAGGGCAGAAA[C/T]GGCACAGGACCAAGGAGATGGGGTG
          Chromosome:
          22:19964609
          Gene:
          COMT (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2181/1092
          HGVS:
          NC_000022.10:g.19952132C>T, NC_000022.11:g.19964609C>T, NG_011526.1:g.27870C>T, NM_000754.3:c.615+310C>T, NM_001135161.1:c.615+310C>T, NM_001135162.1:c.615+310C>T, NM_007310.2:c.465+310C>T, XM_005261229.1:c.615+310C>T, XM_011529886.1:c.729+310C>T, XM_017028594.1:c.615+310C>T, XM_017028595.1:c.615+310C>T
          7.

          rs3218737 [Homo sapiens]
            CRTGGGCRACAAGAAAGGTGGGGTC[C/T]GGGCCAGCAGGTGCTCAGCTCTGGG
            Chromosome:
            22:19962824
            Gene:
            COMT (GeneView) MIR4761 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            by cluster,by frequency
            HGVS:
            NC_000022.10:g.19950347C>T, NC_000022.11:g.19962824C>T, NG_011526.1:g.26085C>T, NM_000754.3:c.289+9C>T, NM_001135161.1:c.289+9C>T, NM_001135162.1:c.289+9C>T, NM_007310.2:c.139+9C>T, NR_039918.1:n.-929C>T, XM_005261229.1:c.289+9C>T, XM_011529886.1:c.403+9C>T, XM_017028594.1:c.289+9C>T, XM_017028595.1:c.289+9C>T
            8.

            rs2239393 [Homo sapiens]
              TTACAGGAGAAGCTGTTATCACCCC[A/G]TTTCCAGGGGGCTGGGAACCCTGGG
              Chromosome:
              22:19962905
              Gene:
              COMT (GeneView) MIR4761 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.3664/1835
              HGVS:
              NC_000022.10:g.19950428A>G, NC_000022.11:g.19962905A>G, NG_011526.1:g.26166A>G, NM_000754.3:c.289+90A>G, NM_001135161.1:c.289+90A>G, NM_001135162.1:c.289+90A>G, NM_007310.2:c.139+90A>G, NR_039918.1:n.-848A>G, XM_005261229.1:c.289+90A>G, XM_011529886.1:c.403+90A>G, XM_017028594.1:c.289+90A>G, XM_017028595.1:c.289+90A>G
              9.

              rs2075507 [Homo sapiens]
                tggactgtgagtatgggaaggggaa[A/G]cttttctgtctgttgtccccactac
                Chromosome:
                22:19940569
                Gene:
                COMT (GeneView) TXNRD2 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.3490/1748
                HGVS:
                NC_000022.10:g.19928092G>A, NC_000022.11:g.19940569G>A, NG_011526.1:g.3830G>A, NG_011835.1:g.6268C>T, NM_000754.3:c.-1420G>A, NM_001282512.1:c.103+1132C>T, NM_006440.3:c.103+1132C>T, NM_006440.4:c.103+1132C>T, XM_005261214.1:c.103+1132C>T, XM_005261216.1:c.103+1132C>T, XM_005261217.1:c.103+1132C>T, XM_005261229.1:c.-1714G>A, XM_017028594.1:c.-1714G>A, XM_017028595.1:c.-1992G>A
                10.

                rs933271 [Homo sapiens]
                  GTGGTTACTTTCTGGAGAGAGCATG[C/T]GGCATGCAGGAGCTGGAGGGGGGGT
                  Chromosome:
                  22:19943884
                  Gene:
                  COMT (GeneView) TXNRD2 (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.4036/2021
                  HGVS:
                  NC_000022.10:g.19931407T>C, NC_000022.11:g.19943884T>C, NG_011526.1:g.7145T>C, NG_011835.1:g.2953A>G, NM_000754.3:c.-92+1987T>C, NM_001282512.1:c.-2081A>G, NM_006440.4:c.-2081A>G, XM_005261229.1:c.-386+1987T>C, XM_017028594.1:c.-386+1987T>C, XM_017028595.1:c.-386+1709T>C
                  11.

                  rs740603 [Homo sapiens]
                    TGTGAGGCACTGAGGATGCCCTCAC[A/G]CGTGCATCTGCATGTGGCGTGCATG
                    Chromosome:
                    22:19957654
                    Gene:
                    COMT (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.4700/2354
                    HGVS:
                    NC_000022.10:g.19945177A>G, NC_000022.11:g.19957654A>G, NG_011526.1:g.20915A>G, NM_000754.3:c.-91-3545A>G, NM_001135161.1:c.-91-3545A>G, NM_001135162.1:c.-91-3545A>G, XM_005261229.1:c.-385-3545A>G, XM_011529886.1:c.-331A>G, XM_017028594.1:c.-385-3545A>G, XM_017028595.1:c.-385-3545A>G
                    12.

                    rs739368 [Homo sapiens]
                      TGGGAACCACCATCCGATCAACCCT[C/T]GGATGCAACAACCGGAGCACACAGT
                      Chromosome:
                      22:19951573
                      Gene:
                      COMT (GeneView)
                      Functional Consequence:
                      intron variant,utr variant 5 prime
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      A=0.0613/307
                      HGVS:
                      NC_000022.10:g.19939096G>A, NC_000022.11:g.19951573G>A, NG_011526.1:g.14834G>A, NM_000754.3:c.-91-9626G>A, NM_001135161.1:c.-92+521G>A, NM_001135162.1:c.-173G>A, XM_005261229.1:c.-385-9626G>A, XM_017028594.1:c.-385-9626G>A, XM_017028595.1:c.-386+9398G>A
                      13.

                      rs737866 [Homo sapiens]
                        CAGGACACAAAAATCCCTGGCTGGA[A/G]AAATCCAAAAAGCAGGTCTGTTAGC
                        Chromosome:
                        22:19942586
                        Gene:
                        COMT (GeneView) TXNRD2 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        C=0.2266/1135
                        HGVS:
                        NC_000022.10:g.19930109T>C, NC_000022.11:g.19942586T>C, NG_011526.1:g.5847T>C, NG_011835.1:g.4251A>G, NM_000754.3:c.-92+689T>C, NM_001282512.1:c.-783A>G, NM_006440.4:c.-783A>G, XM_005261214.1:c.-783A>G, XM_005261216.1:c.-783A>G, XM_005261217.1:c.-783A>G, XM_005261229.1:c.-386+689T>C, XM_017028594.1:c.-386+689T>C, XM_017028595.1:c.-386+411T>C
                        14.

                        rs737865 [Homo sapiens]
                          AATAAAAAGCAACAGGACACAAAAA[C/T]CCCTGGCTGGAAAAATCCAAAAAGC
                          Chromosome:
                          22:19942598
                          Gene:
                          COMT (GeneView) TXNRD2 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.2266/1135
                          HGVS:
                          NC_000022.10:g.19930121A>G, NC_000022.11:g.19942598A>G, NG_011526.1:g.5859A>G, NG_011835.1:g.4239T>C, NM_000754.3:c.-92+701A>G, NM_001282512.1:c.-795T>C, NM_006440.4:c.-795T>C, XM_005261214.1:c.-795T>C, XM_005261216.1:c.-795T>C, XM_005261217.1:c.-795T>C, XM_005261229.1:c.-386+701A>G, XM_017028594.1:c.-386+701A>G, XM_017028595.1:c.-386+423A>G
                          15.

                          rs209603 [Homo sapiens]
                            CATGAGAGTTGACCTCTTCCACATT[A/G]GCCTCAATGCTGTACGAGGCGTCTT
                            Chromosome:
                            1:40412836
                            Gene:
                            SMAP2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.0519/260
                            HGVS:
                            NC_000001.10:g.40878508C>T, NC_000001.11:g.40412836C>T, NM_001198978.1:c.313-180C>T, NM_001198979.1:c.388-180C>T, NM_001198980.1:c.163-180C>T, NM_022733.2:c.403-180C>T, XM_005271119.1:c.460-180C>T, XM_005271120.1:c.325-180C>T, XM_011541960.1:c.325-180C>T, XM_017002093.1:c.-84-180C>T
                            17.
                            18.

                            rs174696 [Homo sapiens]
                              CTGCGTCCGGCCGTATTCCAGCTTT[C/T]AAAACAACAAAAAACAACAAAAACT
                              Chromosome:
                              22:19965653
                              Gene:
                              COMT (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.4809/2402
                              HGVS:
                              NC_000022.10:g.19953176C>T, NC_000022.11:g.19965653C>T, NG_011526.1:g.28914C>T, NM_000754.3:c.615+1354C>T, NM_001135161.1:c.615+1354C>T, NM_001135162.1:c.615+1354C>T, NM_007310.2:c.465+1354C>T, XM_005261229.1:c.615+1354C>T, XM_011529886.1:c.729+1354C>T, XM_017028594.1:c.615+1354C>T, XM_017028595.1:c.615+1354C>T
                              19.

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center