Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs143384 [Homo sapiens]
    TTTCCTGCCAAACCAGAGGCACCTT[C/T]GCTGCTGCCGCTGTTCTCTTTGGTG
    Chromosome:
    20:35437976
    Gene:
    GDF5 (GeneView)
    Functional Consequence:
    utr variant 5 prime
    Clinical significance:
    Benign
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4389/2198
    HGVS:
    NC_000020.10:g.34025756A>G, NC_000020.11:g.35437976G>A, NG_008076.3:g.21771C, NG_008076.3:g.21771C>T, NM_000557.4:c.-48C, NM_000557.4:c.-48C>T, NM_001319138.1:c.-48C, NM_001319138.1:c.-48C>T, XM_011529075.2:c.-48C>T
    2.

    rs143383 [Homo sapiens]
      AGTTGTGCAGGAGAAAGGGGGCGGT[C/T]GGCTTTCTCCTTTCAAGAACGAGTT
      Chromosome:
      20:35438203
      Gene:
      GDF5 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Clinical significance:
      other
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4535/2271
      HGVS:
      NC_000020.10:g.34025983A>G, NC_000020.11:g.35438203G, NC_000020.11:g.35438203G>A, NG_008076.3:g.21544C, NG_008076.3:g.21544C>T, NM_000557.3:c.-275C, NM_000557.3:c.-275C>T, NM_000557.4:c.-275C, NM_000557.4:c.-275C>T, NM_000557.4:c.-275T>C, NM_001319138.1:c.-241-34C, NM_001319138.1:c.-241-34C>T, NM_001319138.1:c.-241-34T>C, XM_011529075.2:c.-241-34C, XM_011529075.2:c.-241-34C>T

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center