Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs12979860 [Homo sapiens]
    TGAACCAGGGAGCTCCCCGAAGGCG[C/T]GAACCAGGGTTGAATTGCACTCCGC
    Chromosome:
    19:39248147
    Gene:
    IFNL3 (GeneView) IFNL4 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3558/1782
    HGVS:
    NC_000019.10:g.39248147C>T, NC_000019.9:g.39738787C>T, NG_042193.1:g.1825G>A, NM_001276254.2:c.151-152G>A, NR_074079.1:n.429-152G>A, XM_011526757.1:c.-1595G>A
    2.

    rs8099917 [Homo sapiens]
      TTTTGTTTTCCTTTCTGTGAGCAAT[G/T]TCACCCAAATTGGAACCATGCTGTA
      Chromosome:
      19:39252525
      Clinical significance:
      drug-response
      Validated:
      no info
      Global MAF:
      G=0.1312/657
      HGVS:
      NC_000019.10:g.39252525T>G, NC_000019.9:g.39743165T>G
      4.

      rs809917 [Homo sapiens]
        TGAGTGACAGAAACAAGTGAACACA[G/T]CCACAATCAACGATCTTCCCATTGT
        Chromosome:
        6:21281085
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2732/1368
        HGVS:
        NC_000006.11:g.21281316T>G, NC_000006.12:g.21281085T>G

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center