Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 11

1.

rs3733890 [Homo sapiens]
    ATGAAGGAGGGCTTGGAGGCTGCCC[A/G]ACTGAAAGCTCACCTGATGAGCCAG
    Chromosome:
    5:79126136
    Gene:
    BHMT (GeneView)
    Functional Consequence:
    missense
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2907/1456
    HGVS:
    NC_000005.10:g.79126136G>A, NC_000005.9:g.78421959G>A, NG_029156.1:g.19356G>A, NM_001713.2:c.716G>A, NP_001704.2:p.Arg239Gln, XM_005248566.1:c.257G>A, XP_005248623.1:p.Arg86Gln
    2.

    rs2298444 [Homo sapiens]
      TCTTCACCCCACCCCAAATCCTTGA[A/G]GATTTTCCAAACCCTACCTCAATCT
      Chromosome:
      11:72221370
      Gene:
      FOLR2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.3516/1761
      HGVS:
      NC_000011.10:g.72221370T>C, NC_000011.9:g.71932414T>C, NG_023253.1:g.1533T>C, NM_000803.4:c.475+59T>C, NM_001113534.1:c.475+59T>C, NM_001113535.1:c.475+59T>C, NM_001113536.1:c.475+59T>C, XM_005273854.1:c.520+59T>C, XM_005273855.1:c.514+59T>C, XM_005273856.1:c.502+59T>C, XM_005273856.3:c.502+59T>C
      3.

      rs2071010 [Homo sapiens]
        CAGACCAGAGTGTGGCCTGCTCAAG[A/G]TTAAACGACAAGTTAGTGTTCATCC
        Chromosome:
        11:72189920
        Gene:
        FOLR1 (GeneView)
        Functional Consequence:
        intron variant,utr variant 5 prime
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        Uncertain significance
        Validated:
        by 1000G,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.0984/493
        HGVS:
        NC_000011.10:g.72189920G>A, NC_000011.9:g.71900964G>A, NG_015863.1:g.5363G>A, NM_000802.3:c.-20G>A, NM_016724.2:c.-75+161G>A, NM_016725.2:c.-9+161G>A
        6.

        rs1801198 [Homo sapiens]
          CAGTTCCTCATGACTTCCCCCATGC[A/C/G]TGGGGCAGAACTGGGAACAGCATGT
          Chromosome:
          22:30615623
          Gene:
          TCN2 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/C(germline)
          Clinical significance:
          Benign
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4203/2105
          HGVS:
          NC_000022.10:g.31011610G>C, NC_000022.11:g.30615623G>C, NG_007263.1:g.13450G>C, NM_000355.2:c.776G>C, NM_000355.3:c.776G>C, NM_001184726.1:c.695G>C, NP_000346.2:p.Arg259Pro, NP_001171655.1:p.Arg232Pro
          10.

          rs229844 [Homo sapiens]
            AAAAACAAAACAAGACAAAAAAAAA[A/C]CACAAAAAACCCATAAGTAAATAAA
            Chromosome:
            14:83407824
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.0407/204
            HGVS:
            NC_000014.8:g.83874168G>T, NC_000014.9:g.83407824G>T

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center