Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs7575840 [Homo sapiens]
    GTCCATCACAGGGAAAGCCAGGAAT[G/T]GTCAGTACTGAGGTGGAAGTTTTTC
    Chromosome:
    2:21050618
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1839/921
    HGVS:
    NC_000002.11:g.21273490G>T, NC_000002.12:g.21050618G>T
    2.

    rs1367117 [Homo sapiens]
      GTTGAAGCCATACACCTCTTTCAGG[A/G]TGCACTGGCTGGTCTTCAGGATGAA
      Chromosome:
      2:21041028
      Gene:
      APOB (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      other
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1693/848
      HGVS:
      NC_000002.11:g.21263900G>A, NC_000002.12:g.21041028G>A, NG_011793.1:g.8046C>T, NM_000384.2:c.293C>T, NP_000375.2:p.Thr98Ile
      3.

      rs693 [Homo sapiens]
        ACATGAAGGCCAAATTCCGAGAGAC[C/T]CTAGAAGATACACGAGACCGAATGT
        Chromosome:
        2:21009323
        Gene:
        APOB (GeneView)
        Functional Consequence:
        synonymous codon
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2510/1257
        HGVS:
        NC_000002.11:g.21232195G>A, NC_000002.12:g.21009323G>A, NG_011793.1:g.39751C>T, NM_000384.2:c.7545C>T, NP_000375.2:p.Thr2515

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center