Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 13

2.

rs10994336 [Homo sapiens]
    TCCAAATAACAAGTCCACTTTGACG[C/T]CATTAAGCAAAACATTGTACTGGCT
    Chromosome:
    10:60420054
    Gene:
    ANK3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1232/617
    HGVS:
    NC_000010.10:g.62179812C>T, NC_000010.11:g.60420054C>T, NG_029917.1:g.318473G>A, NM_001204403.1:c.97-140415G>A, NM_001204404.1:c.64-140415G>A, XM_005269713.1:c.64-140415G>A, XM_017016114.1:c.64-140415G>A, XM_017016133.1:c.64-140415G>A, XM_017016135.1:c.64-140415G>A, XM_017016148.1:c.64-140415G>A, XM_017016149.1:c.64-140415G>A
    3.

    rs10791345 [Homo sapiens]
      GCTAAACCCTGAGCATGTAGTTAGA[A/G]CATCAGAGGAACCAGGTGAGAAACT
      Chromosome:
      11:134142118
      Gene:
      JAM3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1542/772
      HGVS:
      NC_000011.10:g.134142118G>A, NC_000011.9:g.134012013G>A, NG_028348.1:g.78194G>A, NM_001205329.1:c.256+1348G>A, NM_032801.4:c.256+1348G>A
      5.

      rs9322993 [Homo sapiens]
        ACATACTATAGCTTATTTAACCAGT[C/G/T]TCTTATTGATGGACGTTTGGGTTGC
        Chromosome:
        14:39136338
        Gene:
        GEMIN2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1765/884
        HGVS:
        NC_000014.8:g.39605542T>C, NC_000014.9:g.39136338T>C, NC_000014.9:g.39136338T>G, NG_016643.1:g.27055T>C, NG_016643.1:g.27055T>G, NM_001009182.1:c.759-102T>C, NM_001009182.1:c.759-102T>G, NM_001009183.1:c.745-102T>C, NM_001009183.1:c.745-102T>G, NM_003616.2:c.804-102T>C, NM_003616.2:c.804-102T>G, XM_017021709.1:c.700-102T>C, XM_017021709.1:c.700-102T>G
        7.

        rs4806874 [Homo sapiens]
          GGGAACACTCTCATCACTGCAGAAC[A/G]TGCTATTGGATGGTGGTGGTCCATG
          Chromosome:
          19:2738354
          Gene:
          SLC39A3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.4607/2307
          HGVS:
          NC_000019.10:g.2738354A>G, NC_000019.9:g.2738352A>G, NM_144564.4:c.-122-975T>C, NM_213568.1:c.-122-975T>C, XM_005259548.1:c.-122-975T>C
          8.

          rs2774339 [Homo sapiens]
            ATCCCCCACTCAGCAGAACTGTGCA[C/T]GCGTTCCTGCACATGTGTTGGTGTG
            Chromosome:
            1:235586278
            Gene:
            GNG4 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            T=0.4982/2495
            HGVS:
            NC_000001.10:g.235749578C>T, NC_000001.11:g.235586278C>T, NM_001098721.1:c.-10-2430G>A, NM_001098722.1:c.-10-2430G>A, NM_004485.3:c.-10-2430G>A, XM_006711761.2:c.-10-2430G>A, XM_011544167.2:c.-10-2430G>A
            9.

            rs2209263 [Homo sapiens]
              ATTTTACAGATAAGGAAAAGGGCTC[A/G]GGGAGGTTAAGAAAAATCCTCAATG
              Chromosome:
              9:80911728
              Gene:
              LOC107987084 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.1797/900
              HGVS:
              NC_000009.11:g.83526643C>T, NC_000009.12:g.80911728C>T, XR_001746765.1:n.2714-9806C>T
              10.

              rs1064395 [Homo sapiens]
                ACTTGAAGTAGTGACACCTACCTGC[A/G]GTCATATTGTAGAGAGATGCTCAGT
                Chromosome:
                19:19250926
                Gene:
                NCAN (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                by 1000G,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.2472/1238
                HGVS:
                NC_000019.10:g.19250926G>A, NC_000019.9:g.19361735G>A, NM_004386.2:c.*1015G>A, XM_005259745.1:c.*1015G>A, XM_005259746.1:c.*1015G>A, XM_005259747.1:c.*1015G>A
                11.

                rs1006737 [Homo sapiens]
                  AAGTTCCATTCCATCTCAGCCCGAA[A/G]TGTTTTCAGAGCCGGAGACCTCACA
                  Chromosome:
                  12:2236129
                  Gene:
                  CACNA1C (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.3015/1510
                  HGVS:
                  NC_000012.11:g.2345295G>A, NC_000012.12:g.2236129G>A, NG_008801.2:g.270344G>A, NM_000719.6:c.477+115699G>A, NM_001129827.1:c.477+115699G>A, NM_001129829.1:c.477+115699G>A, NM_001129830.1:c.477+115699G>A, NM_001129830.2:c.477+115699G>A, NM_001129831.1:c.477+115699G>A, NM_001129832.1:c.477+115699G>A, NM_001129833.1:c.477+115699G>A, NM_001129834.1:c.477+115699G>A, NM_001129835.1:c.477+115699G>A, NM_001129836.1:c.477+115699G>A, NM_001129837.1:c.477+115699G>A, NM_001129838.1:c.477+115699G>A, NM_001129839.1:c.477+115699G>A, NM_001129840.1:c.477+115699G>A, NM_001129841.1:c.477+115699G>A, NM_001129842.1:c.477+115699G>A, NM_001129843.1:c.477+115699G>A, NM_001129844.1:c.477+115699G>A, NM_001129846.1:c.477+115699G>A, NM_001167623.1:c.477+115699G>A, NM_001167624.2:c.477+115699G>A, NM_001167625.1:c.477+115699G>A, NM_199460.3:c.477+115699G>A, XM_005253765.1:c.567+115699G>A, XM_005253766.1:c.486+115699G>A, XM_005253767.1:c.486+115699G>A, XM_005253768.1:c.486+115699G>A, XM_005253769.1:c.486+115699G>A, XM_005253770.1:c.486+115699G>A, XM_005253771.1:c.486+115699G>A, XM_005253772.1:c.486+115699G>A, XM_005253773.1:c.486+115699G>A, XM_005253774.1:c.486+115699G>A, XM_005253775.1:c.486+115699G>A, XM_005253776.1:c.486+115699G>A, XM_005253777.1:c.486+115699G>A, XM_005253778.1:c.486+115699G>A, XM_005253779.1:c.486+115699G>A, XM_005253780.1:c.486+115699G>A, XM_005253781.1:c.486+115699G>A, XM_005253782.1:c.486+115699G>A, XM_005253783.1:c.486+115699G>A, XM_005253784.1:c.486+115699G>A, XM_005253785.1:c.486+115699G>A, XM_005253786.1:c.486+115699G>A, XM_005253787.1:c.486+115699G>A, XM_006719017.2:c.567+115699G>A, XM_011521020.2:c.567+115699G>A, XM_011521023.2:c.477+115699G>A, XM_017019926.1:c.645+115699G>A, XM_017019927.1:c.645+115699G>A, XM_017019928.1:c.645+115699G>A, XM_017019929.1:c.645+115699G>A, XM_017019930.1:c.645+115699G>A, XM_017019931.1:c.645+115699G>A, XM_017019932.1:c.645+115699G>A, XM_017019933.1:c.645+115699G>A, XM_017019934.1:c.645+115699G>A, XM_017019935.1:c.645+115699G>A, XM_017019936.1:c.645+115699G>A, XM_017019937.1:c.645+115699G>A, XM_017019938.1:c.645+115699G>A, XM_017019939.1:c.645+115699G>A, XM_017019940.1:c.645+115699G>A, XM_017019941.1:c.645+115699G>A, XM_017019942.1:c.645+115699G>A, XM_017019943.1:c.645+115699G>A, XM_017019944.1:c.645+115699G>A, XM_017019945.1:c.645+115699G>A, XM_017019946.1:c.645+115699G>A, XM_017019947.1:c.645+115699G>A, XM_017019948.1:c.645+115699G>A, XM_017019949.1:c.645+115699G>A, XM_017019950.1:c.645+115699G>A, XM_017019951.1:c.645+115699G>A, XM_017019952.1:c.645+115699G>A, XM_017019953.1:c.567+115699G>A, XM_017019954.1:c.567+115699G>A, XM_017019955.1:c.645+115699G>A
                  12.

                  rs985409 [Homo sapiens]
                    CGATTGCTCTAGTGGGAAGTGCTTT[A/G]CAGTTATCTCATTTCTAAAACAAAA
                    Chromosome:
                    7:104530976
                    Gene:
                    LHFPL3 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    G=0.3708/1857
                    HGVS:
                    NC_000007.13:g.104171423A>G, NC_000007.14:g.104530976A>G, NM_199000.2:c.445+201751A>G, NM_199000.2:c.445+201752A>G, XM_005250327.1:c.445+201751A>G, XM_005250327.1:c.445+201752A>G, XM_005250328.1:c.445+201751A>G, XM_005250329.1:c.445+201751A>G
                    13.

                    rs779279 [Homo sapiens]
                      tttgtctaaaattaatatagctatt[A/C]caggtttcttttcattcgtttctgt
                      Chromosome:
                      3:191826138
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.3746/1876
                      HGVS:
                      NC_000003.11:g.191543927G>T, NC_000003.12:g.191826138G>T

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center