Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 45

1.

rs17441606 [Homo sapiens]
    TTTGGATGATTGCTCTTCAGTGTAG[A/C]AGCTTTATGAAAACATTAAATGTCA
    Chromosome:
    2:19368674
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1643/823
    HGVS:
    NC_000002.11:g.19568435C>A, NC_000002.12:g.19368674C>A
    2.

    rs16982414 [Homo sapiens]
      CGCTGTCATGGAGATCTGTATGAAG[G/T]GCTGTGAGATAACAAGAGAAACATC
      Chromosome:
      21:28417219
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.0325/163
      HGVS:
      NC_000021.8:g.29789540T>G, NC_000021.9:g.28417219T>G
      4.

      rs13161895 [Homo sapiens]
        TTAAAATTCAGAATAACGGTACTTC[C/T]GTTTTTCTTACCTGCCAACTTTTAT
        Chromosome:
        5:180044201
        Gene:
        RNF130 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1456/729
        HGVS:
        NC_000005.10:g.180044201C>T, NC_000005.9:g.179471201C>T, NM_001280801.1:c.248-3554G>A, NM_018434.5:c.248-3554G>A, XM_011534593.2:c.248-3554G>A
        5.

        rs12740374 [Homo sapiens]
          CAGTGCTGGCTCGGCTGCCCTGAGG[G/T]TGCTCAATCAAGCACAGGTTTCAAG
          Chromosome:
          1:109274968
          Gene:
          CELSR2 (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Allele Origin:
          G(germline)/T(germline)
          Clinical significance:
          other
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1955/979
          HGVS:
          NC_000001.10:g.109817590G>T, NC_000001.11:g.109274968G>T, NM_001408.2:c.*919G>T, XM_005270580.1:c.*786G>T, XM_005270580.4:c.*786G>T
          6.

          rs11088655 [Homo sapiens]
            CTGTGGTTTTCCCCTTCTGCTTTAC[C/T]CTTCTTCAAATGTTGTTGTAATGTA
            Chromosome:
            21:17834172
            Gene:
            CHODL (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.2340/1172
            HGVS:
            NC_000021.8:g.19206489C>T, NC_000021.9:g.17834172C>T, XM_011529457.2:c.-226+14558C>T
            9.

            rs10503669 [Homo sapiens]
              CTCACAGTGCATTTAAATTATTTCC[A/C]TGTTAGCATCTATCACTACCTTTCT
              Chromosome:
              8:19990179
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.0875/438
              HGVS:
              NC_000008.10:g.19847690C>A, NC_000008.11:g.19990179C>A
              11.

              rs10218356 [Homo sapiens]
                GCAAGTTGGGGCATGCCGTCACTTC[A/G]AAGAACTTTGATAAATCTTAAGGCG
                Chromosome:
                X:19240194
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4048/1528
                HGVS:
                NC_000023.10:g.19258312A>G, NC_000023.11:g.19240194A>G
                12.

                rs10096633 [Homo sapiens]
                  GTAGGTCGGTAAAGACAATAAATCA[C/T]TGTACTCCCCAGACTTCTCCAACTA
                  Chromosome:
                  8:19973410
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2129/1066
                  HGVS:
                  NC_000008.10:g.19830921C>T, NC_000008.11:g.19973410C>T
                  13.

                  rs9987289 [Homo sapiens]
                    AGCTGACTTTGCTAGATGCTTGGGC[A/G]TCAATATCACGTGGAACCAGCCTTT
                    Chromosome:
                    8:9325848
                    Gene:
                    LOC157273 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1140/571
                    HGVS:
                    NC_000008.10:g.9183358A>G, NC_000008.11:g.9325848A>G, NR_040039.1:n.364-54A>G
                    14.

                    rs9306885 [Homo sapiens]
                      GGCCTGCTCAGCGGGTGGGTCAGTA[C/T]GTAAATAACTGGGCACAGAAAGAGC
                      Chromosome:
                      2:19789071
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.4844/2426
                      HGVS:
                      NC_000002.11:g.19988832T>C, NC_000002.12:g.19789071T>C
                      15.

                      rs8078633 [Homo sapiens]
                        CAACAGCCACGTTTAAAACTACCTA[C/G]AGAGATTCAAATCCCCAAAAGCTAT
                        Chromosome:
                        17:60496504
                        Gene:
                        APPBP2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2358/1181
                        HGVS:
                        NC_000017.10:g.58573865C>G, NC_000017.11:g.60496504C>G, NM_001282476.1:c.15-1887G>C, NM_006380.3:c.228-1887G>C, XM_011524198.2:c.-60-63G>C
                        16.

                        rs8034802 [Homo sapiens]
                          TCCAGTCAGGTCTAAAGTAGAGATA[A/T]CATTGCACAATTTCTAGACTTTGTT
                          Chromosome:
                          15:58432593
                          Gene:
                          LIPC (GeneView) LOC101928635 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.4225/2116
                          HGVS:
                          NC_000015.10:g.58432593T>A, NC_000015.9:g.58724792T>A, NG_011465.1:g.5618T>A, NM_000236.2:c.88+473T>A, XM_005254372.1:c.88+473T>A, XM_005254373.1:c.88+473T>A, XR_001751556.1:n.-823A>T, XR_001751557.1:n.-823A>T, XR_001751558.1:n.-823A>T, XR_001751559.1:n.-823A>T, XR_001751560.1:n.-823A>T, XR_001751563.1:n.-823A>T, XR_001751565.1:n.-823A>T, XR_429537.3:n.-823A>T
                          17.

                          rs7903146 [Homo sapiens]
                            TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG
                            Chromosome:
                            10:112998590
                            Gene:
                            TCF7L2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Allele Origin:
                            T(germline)/C(germline)
                            Clinical significance:
                            drug-response
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.2278/1141
                            HGVS:
                            NC_000010.10:g.114758349C>T, NC_000010.11:g.112998590C>T, NG_012631.1:g.53341C>T, NM_001146274.1:c.450+33966C>T, NM_001146283.1:c.382-41435C>T, NM_001146284.1:c.382-41435C>T, NM_001146285.1:c.382-41435C>T, NM_001146286.1:c.382-41435C>T, NM_001198525.1:c.382-41435C>T, NM_001198526.1:c.382-41435C>T, NM_001198527.1:c.382-41435C>T, NM_001198528.1:c.382-41435C>T, NM_001198529.1:c.382-41435C>T, NM_001198530.1:c.381+46983C>T, NM_001198531.1:c.450+33966C>T, NM_030756.4:c.382-41435C>T, XM_005270071.1:c.450+33966C>T, XM_005270072.1:c.450+33966C>T, XM_005270073.1:c.450+33966C>T, XM_005270074.1:c.450+33966C>T, XM_005270075.1:c.450+33966C>T, XM_005270076.1:c.450+33966C>T, XM_005270077.1:c.450+33966C>T, XM_005270078.1:c.450+33966C>T, XM_005270079.1:c.450+33966C>T, XM_005270080.1:c.382-41435C>T, XM_005270081.1:c.382-41435C>T, XM_005270082.1:c.450+33966C>T, XM_005270083.1:c.450+33966C>T, XM_005270084.1:c.450+33966C>T, XM_005270085.1:c.450+33966C>T, XM_005270086.1:c.382-41435C>T, XM_005270087.1:c.382-41435C>T, XM_005270088.1:c.382-41435C>T, XM_005270089.1:c.382-41435C>T, XM_005270090.1:c.381+46983C>T, XM_005270091.1:c.450+33966C>T, XM_005270091.2:c.450+33966C>T, XM_005270092.1:c.450+33966C>T, XM_005270093.1:c.450+33966C>T, XM_005270093.2:c.450+33966C>T, XM_005270094.1:c.450+33966C>T, XM_005270094.2:c.450+33966C>T, XM_005270095.1:c.450+33966C>T, XM_005270096.1:c.450+33966C>T, XM_005270096.2:c.450+33966C>T, XM_005270100.1:c.450+33966C>T, XM_005270101.1:c.382-41435C>T, XM_005270101.2:c.382-41435C>T, XM_005270102.1:c.450+33966C>T, XM_005270103.1:c.382-41435C>T, XM_005270104.1:c.382-41435C>T, XM_011540109.1:c.450+33966C>T, XM_011540110.1:c.382-41435C>T, XM_011540111.1:c.382-41435C>T, XM_011540113.2:c.450+33966C>T, XM_011540116.1:c.450+33966C>T, XM_017016584.1:c.450+33966C>T, XM_017016585.1:c.450+33966C>T, XM_017016586.1:c.450+33966C>T, XM_017016587.1:c.450+33966C>T, XM_017016588.1:c.382-41435C>T, XM_017016589.1:c.450+33966C>T, XM_017016590.1:c.450+33966C>T, XM_017016591.1:c.450+33966C>T, XM_017016592.1:c.450+33966C>T, XM_017016593.1:c.450+33966C>T, XM_017016594.1:c.382-41435C>T, XM_017016595.1:c.450+33966C>T, XM_017016596.1:c.450+33966C>T
                            19.

                            rs7560236 [Homo sapiens]
                              GATCTACCTTTCAAATTCTGGTTTT[C/T]CTGTCTAAAACAAATGTCTTCCACA
                              Chromosome:
                              2:22853911
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.0515/258
                              HGVS:
                              NC_000002.11:g.23076783C>T, NC_000002.12:g.22853911C>T
                              20.

                              rs7323893 [Homo sapiens]
                                atgctgacaactgaaggttgagagg[C/T]gcagaaaagaattttattaagcaat
                                Chromosome:
                                13:88052451
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.0286/143
                                HGVS:
                                NC_000013.10:g.88704706T>C, NC_000013.11:g.88052451T>C

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center