Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs3093077 [Homo sapiens]
    AGGACAACTGCCCACTAGTCTCAGA[A/G/T]GGGTTGTCGTACTTGCCTGGATTCC
    Chromosome:
    1:159709846
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1673/838
    HGVS:
    NC_000001.10:g.159679636A>C, NC_000001.11:g.159709846A>C, NC_000001.11:g.159709846A>T
    3.

    rs1130864 [Homo sapiens]
      GGAGCTCGTTAACTATGCTGGGAAA[C/T]GGTCCAAAAGAATCAGAATTTGAGG
      Chromosome:
      1:159713301
      Gene:
      CRP (GeneView)
      Functional Consequence:
      intron variant,utr variant 3 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.2047/1025
      HGVS:
      NC_000001.10:g.159683091G>A, NC_000001.11:g.159713301G>A, NG_013007.1:g.6289C>T, NM_000567.2:c.*224C>T, NM_001329057.1:c.*22+202C>T, NM_001329058.1:c.*22+202C>T, XM_005244904.1:c.*22+202C>T, XM_011509207.2:c.*22+202C>T
      4.

      rs1205 [Homo sapiens]
        ACTTCCAGTTTGGCTTCTGTCCTCA[C/T]AGTCTCTCTCCATGTGGCAAACAAG
        Chromosome:
        1:159712443
        Gene:
        CRP (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        T=0.3383/1694
        HGVS:
        NC_000001.10:g.159682233C>T, NC_000001.11:g.159712443C>T, NG_013007.1:g.7147G>A, NM_000567.2:c.*1082G>A, NM_001329057.1:c.*374G>A, NM_001329058.1:c.*148G>A, XM_005244904.1:c.*374G>A, XM_011509207.2:c.*374G>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center