Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 22

1.

rs62113226 [Homo sapiens]
    CACATTTTCTTTAACCAATCCACCA[C/T]TGATGGGCAACTAGGTAGATTCCAT
    Chromosome:
    19:50864188
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.0677/339
    HGVS:
    NC_000019.10:g.50864188T>C, NC_000019.9:g.51367444T>C
    2.

    rs62113216 [Homo sapiens]
      TGTCTGAACACCCAACACATAGCAC[A/T]GGAGATATGAGCTCGACAAGAGTTT
      Chromosome:
      19:50861547
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0948/475
      HGVS:
      NC_000019.10:g.50861547T>A, NC_000019.9:g.51364803T>A, NG_011653.1:g.11633T>A
      3.

      rs62113214 [Homo sapiens]
        AGGACACTGCTTTTCCTCTGAGGAG[G/T]CAGGAACTGTGGATGGTGCTGGACA
        Chromosome:
        19:50859281
        Gene:
        KLK3 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.0282/141
        HGVS:
        NC_000019.10:g.50859281T>G, NC_000019.9:g.51362537T>G, NG_011653.1:g.9367T>G, NM_001030047.1:c.631-249T>G, NM_001030048.1:c.501+686T>G, NM_001648.2:c.630+686T>G, XM_005258875.1:c.648+686T>G
        4.

        rs62113212 [Homo sapiens]
          ACTCTATCATCCCCCGGATTCCTCT[C/T]TACTTGGTTCTCATTCTTCCTTTGA
          Chromosome:
          19:50857584
          Gene:
          KLK3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.0282/141
          HGVS:
          NC_000019.10:g.50857584C>T, NC_000019.9:g.51360840C>T, NG_011653.1:g.7670C>T, NM_001030047.1:c.207-445C>T, NM_001030048.1:c.207-574C>T, NM_001648.2:c.207-445C>T, XM_005258875.1:c.207-445C>T
          5.

          rs56397626 [Homo sapiens]
            ATTATTCTTAGGTTGGTTGTTTAAC[A/G]TAATCCCAAACTTCTTGGAGGTCTT
            Chromosome:
            19:50843266
            Gene:
            LOC105372441 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            G=0.1046/524
            HGVS:
            NC_000019.10:g.50843266A>G, NC_000019.9:g.51346522A>G, NR_131203.1:n.214-7645A>G, NR_131205.1:n.231-7645A>G
            6.

            rs55799315 [Homo sapiens]
              TTCCAACTAAGGAAGCTCACCTGAG[C/G]CTTAGTGTCCAGAGTTTTTATTGGG
              Chromosome:
              19:50860967
              Gene:
              KLK3 (GeneView)
              Functional Consequence:
              downstream variant 500B
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              G=0.0803/402
              HGVS:
              NC_000019.10:g.50860967C>G, NC_000019.9:g.51364223C>G, NG_011653.1:g.11053C>G, NM_001030047.1:c.*1351C>G, NM_001030048.1:c.*840C>G, NM_001648.2:c.*840C>G, XM_005258875.1:c.*840C>G
              7.

              rs34750956 [Homo sapiens]
                CACCTCCCCGTGTCTCATCTCATTC[C/T]CTCCTTCCCTCTTCTTTGACTCCCT
                Chromosome:
                19:50858740
                Gene:
                KLK3 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                T=0.0877/439
                HGVS:
                NC_000019.10:g.50858740C>T, NC_000019.9:g.51361996C>T, NG_011653.1:g.8826C>T, NM_001030047.1:c.630+145C>T, NM_001030048.1:c.501+145C>T, NM_001648.2:c.630+145C>T, XM_005258875.1:c.648+145C>T
                8.

                rs17632542 [Homo sapiens]
                  CTTCAGTGTGTGGACCTCCATGTTA[C/T]TTCCAATGACGTGTGTGCGCAAGTT
                  Chromosome:
                  19:50858501
                  Gene:
                  KLK3 (GeneView)
                  Functional Consequence:
                  missense
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.0282/141
                  HGVS:
                  NC_000019.10:g.50858501T>C, NC_000019.9:g.51361757T>C, NG_011653.1:g.8587T>C, NM_001030047.1:c.536T>C, NM_001030048.1:c.407T>C, NM_001648.2:c.536T>C, NP_001025218.1:p.Ile179Thr, NP_001025219.1:p.Ile136Thr, NP_001639.1:p.Ile179Thr, XM_005258875.1:c.554T>C, XP_005258932.1:p.Ile185Thr
                  9.

                  rs11665698 [Homo sapiens]
                    ATACTTCTTCTGTCACATCCTGCTT[A/C]TTTATGCCTAACCAAGGTTCTAGGT
                    Chromosome:
                    19:50851155
                    Gene:
                    LOC105372441 (GeneView)
                    Functional Consequence:
                    downstream variant 500B
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4261/2134
                    HGVS:
                    NC_000019.10:g.50851155A>C, NC_000019.9:g.51354411A>C, NG_011653.1:g.1241A>C, NR_131203.1:n.458A>C, NR_131205.1:n.475A>C
                    10.

                    rs11084034 [Homo sapiens]
                      CTGGGAGGAGACATCCTGCAGAAGG[C/T]GGGAGTGAGCAAACACCTGCCGCAG
                      Chromosome:
                      19:50859048
                      Gene:
                      KLK3 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2570/1287
                      HGVS:
                      NC_000019.10:g.50859048C>T, NC_000019.9:g.51362304C>T, NG_011653.1:g.9134C>T, NM_001030047.1:c.630+453C>T, NM_001030048.1:c.501+453C>T, NM_001648.2:c.630+453C>T, XM_005258875.1:c.648+453C>T
                      11.

                      rs8104556 [Homo sapiens]
                        acaaaaacaggcattcatcatgaat[C/T]gcactgttagcatgaatcatctggc
                        Chromosome:
                        19:50861124
                        Gene:
                        KLK3 (GeneView)
                        Functional Consequence:
                        downstream variant 500B
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.1260/631
                        HGVS:
                        NC_000019.10:g.50861124C>T, NC_000019.9:g.51364380C>T, NG_011653.1:g.11210C>T, NM_001030047.1:c.*1508C>T, NM_001030048.1:c.*997C>T, NM_001648.2:c.*997C>T, XM_005258875.1:c.*997C>T
                        12.

                        rs4802755 [Homo sapiens]
                          CACCTGAGCCTTAGTGTCCAGAGTT[C/T]TTATTGGGGGTCTGTAGGATAGGCA
                          Chromosome:
                          19:50860984
                          Gene:
                          KLK3 (GeneView)
                          Functional Consequence:
                          downstream variant 500B
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.3427/1716
                          HGVS:
                          NC_000019.10:g.50860984T>C, NC_000019.9:g.51364240T>C, NG_011653.1:g.11070T>C, NM_001030047.1:c.*1368T>C, NM_001030048.1:c.*857T>C, NM_001648.2:c.*857T>C, XM_005258875.1:c.*857T>C
                          13.

                          rs2735839 [Homo sapiens]
                            AGGGATCTGGTTCTGTCTTGTGGCC[A/G]AGTGGACCATGGGGCTATCCCAAGA
                            Chromosome:
                            19:50861367
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.3245/1625
                            HGVS:
                            NC_000019.10:g.50861367A>G, NC_000019.9:g.51364623A>G, NG_011653.1:g.11453A>G
                            14.

                            rs2659124 [Homo sapiens]
                              GAACTGACACTTTCCCTCCCCCAGT[A/T]CCTTCACATCCAGCCTCTTCCTCCT
                              Chromosome:
                              19:50851341
                              Gene:
                              LOC105372441 (GeneView)
                              Functional Consequence:
                              downstream variant 500B
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.2716/1360
                              HGVS:
                              NC_000019.10:g.50851341A>T, NC_000019.9:g.51354597A>T, NG_011653.1:g.1427A>T, NR_131203.1:n.644A>T, NR_131205.1:n.661A>T
                              15.

                              rs2659122 [Homo sapiens]
                                GGTAGGGGCTCCAGTCCTGGCCGGT[A/G]GGGAAGGGACTTCAGGGTCCAGCTC
                                Chromosome:
                                19:50859770
                                Gene:
                                KLK3 (GeneView)
                                Functional Consequence:
                                intron variant,utr variant 3 prime
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.4321/2164
                                HGVS:
                                NC_000019.10:g.50859770C>T, NC_000019.9:g.51363026C>T, NG_011653.1:g.9856C>T, NM_001030047.1:c.*154C>T, NM_001030048.1:c.502-202C>T, NM_001648.2:c.631-202C>T, XM_005258875.1:c.649-202C>T
                                16.

                                rs2569735 [Homo sapiens]
                                  ttgggggtctgtaggataggcatgg[A/G]gtactggaatagctgaccttaactt
                                  Chromosome:
                                  19:50861013
                                  Gene:
                                  KLK3 (GeneView)
                                  Functional Consequence:
                                  downstream variant 500B
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  A=0.3307/1656
                                  HGVS:
                                  NC_000019.10:g.50861013A>G, NC_000019.9:g.51364269A>G, NG_011653.1:g.11099A>G, NM_001030047.1:c.*1397A>G, NM_001030048.1:c.*886A>G, NM_001648.2:c.*886A>G, XM_005258875.1:c.*886A>G
                                  17.

                                  rs1058274 [Homo sapiens]
                                    TTGGAAATGACCAGGCCAAGACTCA[A/G]GCCTCCCCAGTTCTACTGACCTTTG
                                    Chromosome:
                                    19:50860192
                                    Gene:
                                    KLK3 (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency
                                    Global MAF:
                                    G=0.2041/1022
                                    HGVS:
                                    NC_000019.10:g.50860192A>G, NC_000019.9:g.51363448A>G, NG_011653.1:g.10278A>G, NM_001030047.1:c.*576A>G, NM_001030048.1:c.*65A>G, NM_001648.2:c.*65A>G, XM_005258875.1:c.*65A>G
                                    18.

                                    rs1058205 [Homo sapiens]
                                      CCAACCCCTGAGCACCCCTATCAAC[C/T]CCCTATTGTAGTAAACTTGGAACCT
                                      Chromosome:
                                      19:50860142
                                      Gene:
                                      KLK3 (GeneView)
                                      Functional Consequence:
                                      utr variant 3 prime
                                      Validated:
                                      by 1000G,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      C=0.3690/1848
                                      HGVS:
                                      NC_000019.10:g.50860142C>T, NC_000019.9:g.51363398C>T, NG_011653.1:g.10228C>T, NM_001030047.1:c.*526C>T, NM_001030048.1:c.*15C>T, NM_001648.2:c.*15C>T, XM_005258875.1:c.*15C>T
                                      19.

                                      rs266878 [Homo sapiens]
                                        GCACTTATCCCTGGTTCCTAGCACC[C/G]CTTATCCCCTCAGAATCCACAACTT
                                        Chromosome:
                                        19:50855858
                                        Gene:
                                        KLK3 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        G=0.2580/1292
                                        HGVS:
                                        NC_000019.10:g.50855858G>C, NC_000019.9:g.51359114G>C, NG_011653.1:g.5944G>C, NM_001030047.1:c.47-382G>C, NM_001030048.1:c.47-382G>C, NM_001648.2:c.47-382G>C, XM_005258875.1:c.47-382G>C
                                        20.

                                        rs266876 [Homo sapiens]
                                          CTCTCTCCCTTTTCTCTCCCACACT[C/T]TATCATCCCCCGGATTCCTCTCTAC
                                          Chromosome:
                                          19:50857562
                                          Gene:
                                          KLK3 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                          Global MAF:
                                          C=0.4085/2046
                                          HGVS:
                                          NC_000019.10:g.50857562C>T, NC_000019.9:g.51360818C>T, NG_011653.1:g.7648C>T, NM_001030047.1:c.207-467C>T, NM_001030048.1:c.207-596C>T, NM_001648.2:c.207-467C>T, XM_005258875.1:c.207-467C>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center