Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 36

1.

rs17239726 [Homo sapiens]
    ATCCTAATTGTATTAAGTGGTGCAC[A/G]TCCTCAATGATGTAGTTTTAAAATT
    Chromosome:
    9:115009233
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1380/691
    HGVS:
    NC_000009.11:g.117771512G>A, NC_000009.12:g.115009233G>A
    3.

    rs12555312 [Homo sapiens]
      caaacacagtgctgggactacaaga[C/G]ggtcaataaatgtCACAGGCTCATG
      Chromosome:
      9:115017375
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0805/403
      HGVS:
      NC_000009.11:g.117779654G>C, NC_000009.12:g.115017375G>C
      5.

      rs12156617 [Homo sapiens]
        ctgggttcctactgactcctgaaac[C/T]tcatcttccacAATGCATCTTTTGC
        Chromosome:
        9:115016064
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1300/651
        HGVS:
        NC_000009.11:g.117778343C>T, NC_000009.12:g.115016064C>T
        7.

        rs11787664 [Homo sapiens]
          GGGGACTGCAGTGTAGAGGAGAAGG[C/T]GATATTCCTAATAGACATTCTTCCT
          Chromosome:
          9:115019377
          Gene:
          TNC (GeneView)
          Functional Consequence:
          downstream variant 500B
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.3480/1743
          HGVS:
          NC_000009.11:g.117781656C>T, NC_000009.12:g.115019377C>T, NG_029637.1:g.103881G>A, NM_002160.3:c.*1780G>A
          8.

          rs10817691 [Homo sapiens]
            CTAAAATCTGGACAGGAGGGTAGGA[A/C]CTGGTACCTTGGGCCAGGCAGCTTG
            Chromosome:
            9:114957982
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4840/2424
            HGVS:
            NC_000009.11:g.117720262A>C, NC_000009.12:g.114957982A>C
            10.

            rs10117421 [Homo sapiens]
              tcatcttccacAATGCATCTTTTGC[A/C]CCTATGCCTCTGGCTTTCTCTGTGC
              Chromosome:
              9:115016090
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.1212/607
              HGVS:
              NC_000009.11:g.117778369A>C, NC_000009.12:g.115016090A>C
              12.

              rs4978617 [Homo sapiens]
                TGCCAGGAAAAGCCACTTCACAGGA[C/T]GCTGCAGTAATATCAGGCAGCTCCC
                Chromosome:
                9:115002569
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.4353/2180
                HGVS:
                NC_000009.11:g.117764849C>T, NC_000009.12:g.115002569C>T
                13.

                rs4452883 [Homo sapiens]
                  gttttctacatgacatggaatagtt[C/T]gatttgtctcacaggtgactatgat
                  Chromosome:
                  9:115017295
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.1546/774
                  HGVS:
                  NC_000009.11:g.117779574C>T, NC_000009.12:g.115017295C>T
                  19.

                  rs2873892 [Homo sapiens]
                    ATGGTGTCATCGAAATGTCATACTC[A/G]GTAGCTTCTGGTAATTTGAAAGAAC
                    Chromosome:
                    8:139234730
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2043/1023
                    HGVS:
                    NC_000008.10:g.140246973G>A, NC_000008.11:g.139234730G>A

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center