Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

2.

rs2671110 [Homo sapiens]
    ACTGAACAGGATCATTCTAGATAAT[A/C]AATAGATGAATACAGAGAATAGTGC
    Chromosome:
    7:132147298
    Gene:
    PLXNA4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2853/1429
    HGVS:
    NC_000007.13:g.131832057G>T, NC_000007.14:g.132147298G>T, NM_020911.1:c.4865-598C>A, XM_005250686.1:c.4865-598C>A, XM_005250686.4:c.4865-598C>A, XM_006716171.3:c.4865-598C>A, XM_017012779.1:c.4664-598C>A
    3.

    rs1373302 [Homo sapiens]
      TACTGAGCATTTAAAATGTGGCTAG[A/T]GTTACTGGAAAACAAATTTTTAACT
      Chromosome:
      8:72045481
      Gene:
      MSC-AS1 (GeneView) TRPA1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4325/2166
      HGVS:
      NC_000008.10:g.72957716T>A, NC_000008.11:g.72045481T>A, NG_033890.1:g.35104A>T, NM_007332.2:c.2061+1032A>T, NR_033651.1:n.434-7058T>A, NR_033652.1:n.1029-7058T>A, XM_011517624.2:c.2136+1032A>T, XM_011517625.2:c.2061+1032A>T, XM_017013946.1:c.2061+1032A>T, XR_242447.1:n.528-7058T>A, XR_242448.1:n.167-7058T>A
      4.

      rs3287 [Homo sapiens]
        ACACAAATAAGCAGCTAATGGCAAT[A/G]CTAGTGGTCTTCCCAATTCACAAGA
        Chromosome:
        2:54580520
        Gene:
        SPTBN1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.3373/1689
        HGVS:
        NC_000002.11:g.54807657T>C, NC_000002.12:g.54580520T>C, NG_029817.1:g.129204T>C, NM_003128.2:c.149-18572T>C, NM_178313.2:c.110-18572T>C, XM_005264517.1:c.149-18572T>C, XM_005264517.2:c.149-18572T>C, XM_005264518.1:c.110-18572T>C, XM_006712087.2:c.149-18572T>C, XM_017004779.1:c.149-18572T>C, XM_017004780.1:c.149-18572T>C, XM_017004781.1:c.149-18572T>C

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center