Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

1.

rs10776799 [Homo sapiens]
    CTGTTCTGAAAGGCTACACACAGTC[A/G/T]CCATCTAACAATAAATGGTAAAAGA
    Chromosome:
    1:115330426
    Gene:
    NGF (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3752/1879
    HGVS:
    NC_000001.10:g.115873047G>T, NC_000001.11:g.115330426G>A, NC_000001.11:g.115330426G>T, NG_007944.1:g.12811C>A, NG_007944.1:g.12811C>T, NM_002506.2:c.-137+7778C>A, NM_002506.2:c.-137+7778C>T, XM_006710663.3:c.-13+7778C>A, XM_006710663.3:c.-13+7778C>T
    2.

    rs6678788 [Homo sapiens]
      TCTGATGTACTTCTTCTAGAGCTTG[C/T]CCTGTCCTGGGTTTCATGCTTTAAA
      Chromosome:
      1:115297050
      Gene:
      NGF (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3712/1859
      HGVS:
      NC_000001.10:g.115839671T>C, NC_000001.11:g.115297050T>C, NG_007944.1:g.46187A>G, NM_002506.2:c.-136-3300A>G, XM_006710663.3:c.-12-10243A>G, XM_011541518.2:c.30-3300A>G
      3.

      rs6537860 [Homo sapiens]
        TTGATAGTGACCTGGGGAGTTGAGT[A/G]ACATTCTATTGCCATGAGGATAAAA
        Chromosome:
        1:115313723
        Gene:
        NGF (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4495/2251
        HGVS:
        NC_000001.10:g.115856344A>G, NC_000001.11:g.115313723A>G, NG_007944.1:g.29514T>C, NM_002506.2:c.-136-19973T>C, XM_006710663.3:c.-13+24481T>C
        4.

        rs4529705 [Homo sapiens]
          AGGCTGAGACTTGAATATACCATTC[A/G]TCAGTCAGAGTTGGTTCCCATTCAA
          Chromosome:
          1:115308870
          Gene:
          NGF (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4487/2247
          HGVS:
          NC_000001.10:g.115851491A>G, NC_000001.11:g.115308870A>G, NG_007944.1:g.34367T>C, NM_002506.2:c.-136-15120T>C, XM_006710663.3:c.-12-22063T>C
          5.

          rs4332358 [Homo sapiens]
            AGCAAGTGAGACATGCAAGTCACTC[C/T]ATTACTAATGAGGGTTGTAATCCAT
            Chromosome:
            1:115333024
            Gene:
            NGF (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4814/2411
            HGVS:
            NC_000001.10:g.115875645C>T, NC_000001.11:g.115333024C>T, NG_007944.1:g.10213G>A, NM_002506.2:c.-137+5180G>A, XM_006710663.3:c.-13+5180G>A
            6.

            rs3811014 [Homo sapiens]
              TACTTTTGTAGAAAGGGCCATTCAC[A/G/T]GTGTTCCCTGGCCTCTTGCCCTCAC
              Chromosome:
              1:115339882
              Gene:
              NGF (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2790/1397
              HGVS:
              NC_000001.10:g.115882503T>A, NC_000001.10:g.115882503T>C, NC_000001.11:g.115339882T>A, NC_000001.11:g.115339882T>C, NG_007944.1:g.3355A>G, NG_007944.1:g.3355A>T, NM_002506.2:c.-1815A>G, NM_002506.2:c.-1815A>T, XM_006710663.3:c.-1691A>G, XM_006710663.3:c.-1691A>T
              7.

              rs2856813 [Homo sapiens]
                TGGAGCAAGAAGACTATTTTGAGCA[A/G]GATGGGAAAGGAAGAAGAATGGAGA
                Chromosome:
                1:115295298
                Gene:
                NGF (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                T=0.3944/1975
                HGVS:
                NC_000001.10:g.115837919C>T, NC_000001.11:g.115295298C>T, NG_007944.1:g.47939G>A, NM_002506.2:c.-136-1548G>A, XM_006710663.3:c.-12-8491G>A, XM_011541518.2:c.30-1548G>A
                8.

                rs2268793 [Homo sapiens]
                  TTGCTGCCAACTGAATATTCAGTCC[A/G/T]CTAAGAGTTGACCGGACATTTATCT
                  Chromosome:
                  1:115289162
                  Gene:
                  NGF (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  T=0.1544/773
                  HGVS:
                  NC_000001.10:g.115831783C>T, NC_000001.11:g.115289162C>A, NC_000001.11:g.115289162C>T, NG_007944.1:g.54075G>A, NG_007944.1:g.54075G>T, NM_002506.2:c.-12-2355G>A, NM_002506.2:c.-12-2355G>T, XM_006710663.3:c.-12-2355G>A, XM_006710663.3:c.-12-2355G>T, XM_011541518.2:c.154-2355G>A, XM_011541518.2:c.154-2355G>T
                  9.

                  rs2239622 [Homo sapiens]
                    GATGAAGATATGTGGTGGGGATCCA[C/T]GCTGGAAAAAGATATCACAGGGAGA
                    Chromosome:
                    1:115295088
                    Gene:
                    NGF (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    A=0.2955/1480
                    HGVS:
                    NC_000001.10:g.115837709A>G, NC_000001.11:g.115295088A>G, NG_007944.1:g.48149T>C, NM_002506.2:c.-136-1338T>C, XM_006710663.3:c.-12-8281T>C, XM_011541518.2:c.30-1338T>C
                    10.

                    rs1146611 [Homo sapiens]
                      gtctcaatctcctgaccttgtgatc[C/T]gcccacattggcctcccaaggtgct
                      Chromosome:
                      1:75775709
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      A=0.0966/484
                      HGVS:
                      NC_000001.10:g.76241394G>A, NC_000001.11:g.75775709G>A, NG_007045.2:g.56352G>A
                      11.

                      rs910330 [Homo sapiens]
                        CTGGTTGCATATTTCTATCATGGGC[A/C]TTTCAAGTGCTTTTAGATCAAGTCT
                        Chromosome:
                        1:115292879
                        Gene:
                        NGF (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.3289/1647
                        HGVS:
                        NC_000001.10:g.115835500T>G, NC_000001.11:g.115292879T>G, NG_007944.1:g.50358A>C, NM_002506.2:c.-13+748A>C, XM_006710663.3:c.-12-6072A>C, XM_011541518.2:c.153+748A>C
                        12.

                        rs308956 [Homo sapiens]
                          TTGTGTCTAATTGTGAAGTTTCCAC[A/G]CCTTTACACCACTCAGAGAGCTGAA
                          Chromosome:
                          3:12147158
                          Gene:
                          SYN2 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.3810/1908
                          HGVS:
                          NC_000003.11:g.12188658G>A, NC_000003.12:g.12147158G>A, NG_011728.2:g.147771G>A, NM_003178.5:c.684+1323G>A, NM_133625.4:c.684+1323G>A, XM_006713311.3:c.684+1323G>A, XM_006713312.3:c.201+191G>A, XM_006713313.2:c.-1621G>A, XR_001740240.1:n.870+1323G>A
                          13.

                          rs6330 [Homo sapiens]
                            CCTGCAGGACACACCATCCCCCAAG[C/T]CCACTGGACTAAACTTCAGCATTCC
                            Chromosome:
                            1:115286692
                            Gene:
                            NGF (GeneView)
                            Functional Consequence:
                            missense
                            Clinical significance:
                            Benign
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            A=0.2474/1239
                            HGVS:
                            NC_000001.10:g.115829313G>A, NC_000001.11:g.115286692G>A, NG_007944.1:g.56545C>T, NM_002506.2:c.104C>T, NP_002497.2:p.Ala35Val, XM_006710663.3:c.104C>T, XM_011541518.2:c.269C>T, XP_006710726.1:p.Ala35Val, XP_011539820.1:p.Ala90Val
                            14.

                            rs6328 [Homo sapiens]
                              GCTGACCCAGTGCACTGTCTGAAAG[C/G/T]GGGTACCCAGTTCTGAGGCTTCAAG
                              Chromosome:
                              1:115287322
                              Gene:
                              NGF (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.3946/1976
                              HGVS:
                              NC_000001.10:g.115829943C>A, NC_000001.11:g.115287322C>A, NC_000001.11:g.115287322C>G, NG_007944.1:g.55915G>C, NG_007944.1:g.55915G>T, NM_002506.2:c.-12-515G>C, NM_002506.2:c.-12-515G>T, XM_006710663.3:c.-12-515G>C, XM_006710663.3:c.-12-515G>T, XM_011541518.2:c.154-515G>C, XM_011541518.2:c.154-515G>T
                              15.

                              rs6326 [Homo sapiens]
                                ACCAAGTTGGGGGATTATTTGTGGG[C/G]TAACTGCAGTGCAGTATGGAGTCCT
                                Chromosome:
                                1:115287840
                                Gene:
                                NGF (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                G=0.0925/463
                                HGVS:
                                NC_000001.10:g.115830461C>G, NC_000001.11:g.115287840C>G, NG_007944.1:g.55397G>C, NM_002506.2:c.-12-1033G>C, XM_006710663.3:c.-12-1033G>C, XM_011541518.2:c.154-1033G>C

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center