Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 27

1.

rs41272110 [Homo sapiens]
    AGGTGATGGACAGAGTTATCGAGGC[A/C]CACTCTCCACCACTATCACAGGAAG
    Chromosome:
    6:160585140
    Gene:
    LPA (GeneView)
    Functional Consequence:
    missense
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0595/298
    HGVS:
    NC_000006.11:g.161006172T>G, NC_000006.12:g.160585140T>G, NG_016147.1:g.86236A>C, NM_005577.2:c.4195A>C, NP_005568.2:p.Thr1399Pro, XM_005266985.1:c.4033A>C, XP_005267042.1:p.Thr1345Pro
    2.

    rs11751605 [Homo sapiens]
      CATTTATGGGGATCACAACCCATAA[C/T]TTGTTCATGTGTTTGTGAATAGATG
      Chromosome:
      6:160542198
      Gene:
      LPA (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0375/188
      HGVS:
      NC_000006.11:g.160963230T>C, NC_000006.12:g.160542198T>C, NG_016147.1:g.129178A>G, NM_005577.2:c.5519+490A>G, XM_005266985.1:c.5357+490A>G
      3.

      rs10455872 [Homo sapiens]
        TCAGACACCTTGTTCTCAGAACCCA[A/G]TGTGTTTATACAGGTTAGAGGAGAA
        Chromosome:
        6:160589086
        Gene:
        LPA (GeneView)
        Functional Consequence:
        intron variant
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.0222/111
        HGVS:
        NC_000006.11:g.161010118A>G, NC_000006.12:g.160589086A>G, NG_016147.1:g.82290T>C, NM_005577.2:c.3947+467T>C, XM_005266985.1:c.3785+467T>C
        4.

        rs9457951 [Homo sapiens]
          CCATAAAAGTACCATATGATTGCCA[C/G]AAGCACAAATGGCTCTCAATCACTA
          Chromosome:
          6:160606796
          Gene:
          LPA (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0489/245
          HGVS:
          NC_000006.11:g.161027828C>G, NC_000006.12:g.160606796C>G, NG_016147.1:g.64580G>C, NM_005577.2:c.2604-138G>C, XM_005266985.1:c.2442-138G>C
          5.

          rs9457930 [Homo sapiens]
            TGTTTGGTCATTTGTGGTCCTGATA[G/T]TTTTCTTAATGTGATCTCCTCACCT
            Chromosome:
            6:160500534
            Gene:
            LPAL2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4591/2299
            HGVS:
            NC_000006.11:g.160921566T>G, NC_000006.12:g.160500534T>G, NR_028092.1:n.326+247A>C, NR_028093.1:n.326+247A>C
            6.

            rs9365166 [Homo sapiens]
              TGGCACCTCATATCTGAGACCATTG[C/T]TGCTTGGGATCGAGTTTGTTTCTAC
              Chromosome:
              6:160490876
              Gene:
              LPAL2 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.4577/2292
              HGVS:
              NC_000006.11:g.160911908C>T, NC_000006.12:g.160490876C>T, NR_028092.1:n.508+1905G>A, NR_028093.1:n.508+1905G>A
              7.

              rs9355803 [Homo sapiens]
                GCCTTTGCTCTTCCCTTGCTGGCAA[A/C]CTGTATCTTGTCAGAGCACTGGTGC
                Chromosome:
                6:160482146
                Gene:
                LPAL2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2005/1004
                HGVS:
                NC_000006.11:g.160903178C>A, NC_000006.12:g.160482146C>A, NR_028092.1:n.1164+542G>T, NR_028093.1:n.1164+542G>T
                8.

                rs9346833 [Homo sapiens]
                  TGAGTATTTGTTGAATCATTATATG[C/T]GTATATCATCTGGCAAATGGATGTG
                  Chromosome:
                  6:160663610
                  Gene:
                  LPA (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.4087/2047
                  HGVS:
                  NC_000006.11:g.161084642C>T, NC_000006.12:g.160663610C>T, NG_016147.1:g.7766G>A, NM_005577.2:c.49+556G>A, XM_005266985.1:c.-114+2618G>A
                  9.

                  rs7761293 [Homo sapiens]
                    GGTTCAGAAAAACAATTGAGTAAGT[A/G]AGAGGCACAGGCTGGGTGCTTTGGC
                    Chromosome:
                    6:160549931
                    Gene:
                    LPA (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4391/2199
                    HGVS:
                    NC_000006.11:g.160970963G>A, NC_000006.12:g.160549931G>A, NG_016147.1:g.121445C>T, NM_005577.2:c.4974-1272C>T, XM_005266985.1:c.4812-1272C>T
                    10.

                    rs7755463 [Homo sapiens]
                      CTCACTAAAGGTCCTGTAACAATCA[C/T]AAATCGTCCTCAACTTCTAAACAAC
                      Chromosome:
                      6:160591238
                      Gene:
                      LPA (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.1056/529
                      HGVS:
                      NC_000006.11:g.161012270C>T, NC_000006.12:g.160591238C>T, NG_016147.1:g.80138G>A, NM_005577.2:c.3630-137G>A, XM_005266985.1:c.3468-137G>A
                      11.

                      rs7754188 [Homo sapiens]
                        TACTCAAAGTGTAGTAAAAAGCCTC[A/T]GTGTTAGCCATGGAAAACCATCGTG
                        Chromosome:
                        6:160497382
                        Gene:
                        LPAL2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.2752/1378
                        HGVS:
                        NC_000006.11:g.160918414A>T, NC_000006.12:g.160497382A>T, NR_028092.1:n.326+3399T>A, NR_028093.1:n.326+3399T>A
                        12.

                        rs7754014 [Homo sapiens]
                          TGATCTCTCTCTATAGGACTTTATA[A/T]AGTATTGTGCAAAGTGGAACTAACA
                          Chromosome:
                          6:160497263
                          Gene:
                          LPAL2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.3097/1551
                          HGVS:
                          NC_000006.11:g.160918295A>T, NC_000006.12:g.160497263A>T, NR_028092.1:n.326+3518T>A, NR_028093.1:n.326+3518T>A
                          13.

                          rs6930542 [Homo sapiens]
                            CTGACTCTCATCTGCCTTCCTGCCA[C/T]TTTTATTCTCTAACAACCAGTATCC
                            Chromosome:
                            6:160604515
                            Gene:
                            LPA (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.0491/246
                            HGVS:
                            NC_000006.11:g.161025547T>C, NC_000006.12:g.160604515T>C, NG_016147.1:g.66861A>G, NM_005577.2:c.2945+531A>G, XM_005266985.1:c.2783+531A>G
                            14.

                            rs6926458 [Homo sapiens]
                              AAGTATCAATTCCCTGTGACCCAAG[A/G]TGCAAAAGGCCAACACAACATTCAC
                              Chromosome:
                              6:160598834
                              Gene:
                              LPA (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.2386/1195
                              HGVS:
                              NC_000006.11:g.161019866A>G, NC_000006.12:g.160598834A>G, NG_016147.1:g.72542T>C, NM_005577.2:c.3287+666T>C, XM_005266985.1:c.3125+666T>C
                              15.

                              rs6922216 [Homo sapiens]
                                TTAAATGTTCTCACCAATGTCATca[A/G]ttctataatttctgggcctgtttgt
                                Chromosome:
                                6:160588089
                                Gene:
                                LPA (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.0583/292
                                HGVS:
                                NC_000006.11:g.161009121A>G, NC_000006.12:g.160588089A>G, NG_016147.1:g.83287T>C, NM_005577.2:c.3948-1459T>C, XM_005266985.1:c.3786-1459T>C
                                16.

                                rs6919346 [Homo sapiens]
                                  GTCCAAATAGACTAACTTTAAGTGA[C/T]GTAAGCAAAGGTATCACTTTGTCAG
                                  Chromosome:
                                  6:160539327
                                  Gene:
                                  LPA (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.0625/313
                                  HGVS:
                                  NC_000006.11:g.160960359T>C, NC_000006.12:g.160539327T>C, NG_016147.1:g.132049A>G, NM_005577.2:c.5735+716A>G, XM_005266985.1:c.5573+716A>G
                                  17.

                                  rs6415084 [Homo sapiens]
                                    catgtaaatgaactcatacagaata[C/T]acatggcttctttcctgagtatatt
                                    Chromosome:
                                    6:160559298
                                    Gene:
                                    LPA (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    T=0.3185/1595
                                    HGVS:
                                    NC_000006.11:g.160980330T>C, NC_000006.12:g.160559298T>C, NG_016147.1:g.112078A>G, NM_005577.2:c.4632-1727A>G, XM_005266985.1:c.4470-1727A>G
                                    18.

                                    rs3798220 [Homo sapiens]
                                      GCTCCAAGAACAGCCTAGACACTTC[C/T]ATTTCCTGAACATGAGATTCGAGGT
                                      Chromosome:
                                      6:160540105
                                      Gene:
                                      LPA (GeneView)
                                      Functional Consequence:
                                      missense
                                      Validated:
                                      by 1000G,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      C=0.0513/257
                                      HGVS:
                                      NC_000006.11:g.160961137T>C, NC_000006.12:g.160540105T>C, NG_016147.1:g.131271A>G, NM_005577.2:c.5673A>G, NP_005568.2:p.Ile1891Met, XM_005266985.1:c.5511A>G, XP_005267042.1:p.Ile1837Met
                                      19.

                                      rs3124787 [Homo sapiens]
                                        atgtacaatgtaatgccttaatata[G/T]atgtacactgtgaaattattatcat
                                        Chromosome:
                                        6:160525417
                                        Validated:
                                        by 1000G,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        G=0.3536/1771
                                        HGVS:
                                        NC_000006.11:g.160946449G>T, NC_000006.12:g.160525417G>T
                                        20.

                                        rs2941382 [Homo sapiens]
                                          TATCTTGGATCTCGAAGAAAGCATA[C/T]GTGCATATCTATGGAGAGGTAAATC
                                          Chromosome:
                                          6:160485408
                                          Gene:
                                          LPAL2 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                          Global MAF:
                                          A=0.0873/437
                                          HGVS:
                                          NC_000006.11:g.160906440A>G, NC_000006.12:g.160485408A>G, NR_028092.1:n.850+407T>C, NR_028093.1:n.850+407T>C

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center