Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 22

1.

rs17062281 [Homo sapiens]
    ATACATTTCCTTATAGAAACCAGAG[C/G]ATTGCTTCCACAAAACATTAACAAC
    Chromosome:
    13:74182742
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0427/214
    HGVS:
    NC_000013.10:g.74756879C>G, NC_000013.11:g.74182742C>G
    2.

    rs12419184 [Homo sapiens]
      CAGAGAGAAGCCGCTCACCAGGCCT[C/T]GAGTGGAAGGGGCGCGCCTGCACAT
      Chromosome:
      11:126186413
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1160/581
      HGVS:
      NC_000011.10:g.126186413C>T, NC_000011.9:g.126056308C>T
      3.

      rs12025416 [Homo sapiens]
        ACAGGCTTGATTTCCACATCCTGCC[C/T]AGCACGGGCTTGGTGAAGCTGGCAG
        Chromosome:
        1:116495665
        Gene:
        CD58 (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.4992/2500
        HGVS:
        NC_000001.10:g.117038287T>C, NC_000001.11:g.116495665T>C, XM_017002869.1:c.*9444A>G
        4.

        rs10846336 [Homo sapiens]
          TAGCCAGGCGGTCCTGCTGAATATG[C/T]GTCTGGGTTCTCTAAGGAATCTGGA
          Chromosome:
          12:16369418
          Gene:
          MGST1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1907/955
          HGVS:
          NC_000012.11:g.16522352T>C, NC_000012.12:g.16369418T>C, NM_001267598.1:c.222-6704T>C, XM_006719079.1:c.363-351T>C, XM_011520674.2:c.362+1953T>C
          5.

          rs10244467 [Homo sapiens]
            aactatacacttaaaatcattaaga[C/T]actaaatttatgtgatatgtatttt
            Chromosome:
            7:22771597
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.0937/469
            HGVS:
            NC_000007.13:g.22811216T>C, NC_000007.14:g.22771597T>C
            7.

            rs9596270 [Homo sapiens]
              ATAAGGCATTTCATAAATATTATTT[C/T]CTCTTTCTTTTCATTACGAGGGAAT
              Chromosome:
              13:50268304
              Gene:
              DLEU1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.0349/175
              HGVS:
              NC_000013.10:g.50842440T>C, NC_000013.11:g.50268304T>C, NR_109974.1:n.443-121894T>C
              10.

              rs7137953 [Homo sapiens]
                AGAGAAGTAATTAGCACTTACTTCT[C/T]AGGGTTGTTCGGTCAATCTATAAAC
                Chromosome:
                12:120456882
                Gene:
                GATC (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2109/1056
                HGVS:
                NC_000012.11:g.120894685C>T, NC_000012.12:g.120456882C>T, NM_176818.2:c.255-194C>T, NR_033684.1:n.396-194C>T
                11.

                rs6836440 [Homo sapiens]
                  GTCCAGGGCTGCTTTCTGTGATGGA[A/G]CATAAAAGAATACTTGAGTCAGTGG
                  Chromosome:
                  4:99127355
                  Gene:
                  ADH4 (GeneView) LOC100507053 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.0359/180
                  HGVS:
                  NC_000004.11:g.100048506G>A, NC_000004.12:g.99127355G>A, NM_000670.4:c.844-11C>T, NM_001306171.1:c.901-11C>T, NM_001306172.1:c.901-11C>T, NR_037884.1:n.429-6200G>A, XM_017007713.1:c.901-11C>T, XM_017007714.1:c.901-11C>T, XM_017007715.1:c.844-11C>T
                  12.

                  rs4939490 [Homo sapiens]
                    TTCCGCCCCTCTCAAAGACCCTCTT[C/G]ATGGTTCTGGTGAACGGACAGAGCG
                    Chromosome:
                    11:61026179
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.3844/1925
                    HGVS:
                    NC_000011.10:g.61026179C>G, NC_000011.9:g.60793651C>G
                    13.

                    rs4368946 [Homo sapiens]
                      AAAAGTGGAAGATTAGAAGGAAATA[C/T]CAATAAAGCCAAAGTTGTGAGACAA
                      Chromosome:
                      8:97416460
                      Gene:
                      LOC101927066 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      C=0.1669/836
                      HGVS:
                      NC_000008.10:g.98428688T>C, NC_000008.11:g.97416460T>C, NR_125390.1:n.471+2610A>G, XR_242409.1:n.471+2610A>G
                      19.

                      rs1356122 [Homo sapiens]
                        GAATGTGTAATATTCTACAGGGTGT[C/G]TGCAAAATTGGGAAAAATGGGGCAA
                        Chromosome:
                        3:154465773
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        C=0.1787/895
                        HGVS:
                        NC_000003.11:g.154183562G>C, NC_000003.12:g.154465773G>C
                        20.

                        rs931555 [Homo sapiens]
                          CACCCACTAGCTTAATCTCTGCAGC[A/G/T]CAGTGTTCTTGGTTCAGTTCCTCCA
                          Chromosome:
                          5:35803475
                          Gene:
                          LOC105374724 (GeneView) SPEF2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.1835/919
                          HGVS:
                          NC_000005.10:g.35803475C>A, NC_000005.10:g.35803475C>T, NC_000005.9:g.35803577C>A, NC_000005.9:g.35803577C>T, NM_024867.3:c.5011-3232C>A, NM_024867.3:c.5011-3232C>T, XM_005248376.1:c.5011-3232C>A, XM_005248376.1:c.5011-3232C>T, XM_005248376.3:c.5011-3232C>A, XM_005248376.3:c.5011-3232C>T, XM_005248377.1:c.4996-3232C>A, XM_005248377.1:c.4996-3232C>T, XM_005248377.3:c.4996-3232C>A, XM_005248377.3:c.4996-3232C>T, XM_011514135.2:c.5833-3232C>A, XM_011514135.2:c.5833-3232C>T, XM_011514136.2:c.5833-3232C>A, XM_011514136.2:c.5833-3232C>T, XM_011514137.2:c.5818-3232C>A, XM_011514137.2:c.5818-3232C>T, XM_011514138.2:c.5809-3232C>A, XM_011514138.2:c.5809-3232C>T, XM_011514139.2:c.5758-3232C>A, XM_011514139.2:c.5758-3232C>T, XM_011514140.2:c.5662-3232C>A, XM_011514140.2:c.5662-3232C>T, XM_011514141.2:c.5407-3232C>A, XM_011514141.2:c.5407-3232C>T, XM_011514142.1:c.4987-3232C>A, XM_011514142.1:c.4987-3232C>T, XM_017009880.1:c.5647-3232C>A, XM_017009880.1:c.5647-3232C>T, XM_017009881.1:c.5407-3232C>A, XM_017009881.1:c.5407-3232C>T, XR_001742634.1:n.1703+50845G>A, XR_001742634.1:n.1703+50845G>T, XR_001742635.1:n.1600+50845G>A, XR_001742635.1:n.1600+50845G>T, XR_001742637.1:n.169+23371G>A, XR_001742637.1:n.169+23371G>T, XR_925656.2:n.6891-3232C>A, XR_925656.2:n.6891-3232C>T

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center