Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 16

2.

rs12735613 [Homo sapiens]
    ATTATGGAAAAAATGCGACCAATAG[A/G]TTACTACCAAATTTTTTTAATGGGA
    Chromosome:
    1:118341350
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2408/1206
    HGVS:
    NC_000001.10:g.118883973G>A, NC_000001.11:g.118341350G>A
    3.

    rs10512248 [Homo sapiens]
      GGATGTAGCCCACGATATGTTCTGA[A/C]GTAAATGGCTTTCCAGTTTTCTCCT
      Chromosome:
      9:95497421
      Gene:
      PTCH1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3299/1652
      HGVS:
      NC_000009.11:g.98259703T>G, NC_000009.12:g.95497421T>G, NG_007664.1:g.24545A>C, NM_000264.3:c.394+8986A>C, NM_001083602.1:c.196+8986A>C, NM_001083603.1:c.391+8986A>C, NM_001083604.1:c.-60+8986A>C, NM_001083605.1:c.-60+8986A>C, NM_001083606.1:c.-60+8986A>C, NM_001083607.1:c.-60+8986A>C, XM_005252103.1:c.-95+8986A>C, XR_242599.1:n.785+8986A>C
      5.
      7.

      rs4549631 [Homo sapiens]
        GGCTGCTGTGGAAACTTTTTGCTCT[C/T]CTGGTACAATGTCATAGCTTTTCCT
        Chromosome:
        6:126645162
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        T=0.3988/1997
        HGVS:
        NC_000006.11:g.126966308T>C, NC_000006.12:g.126645162T>C
        8.

        rs3791675 [Homo sapiens]
          GTCAAAGAAATTCAGTCTGTTTATA[A/G]CCTTTAGCATTAGATAAACCACCAA
          Chromosome:
          2:55884174
          Gene:
          EFEMP1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2905/1455
          HGVS:
          NC_000002.11:g.56111309C>T, NC_000002.12:g.55884174C>T, NG_009098.1:g.44624G>A, NM_001039348.2:c.518-2440G>A, NM_001039349.2:c.518-2440G>A, XM_005264204.1:c.908-2440G>A, XM_005264205.1:c.908-2440G>A, XM_005264205.4:c.908-2440G>A, XM_017003586.1:c.518-2440G>A
          9.

          rs2282978 [Homo sapiens]
            GGATGACTCATTGCATTGGATCATC[C/T]TTGGGAAACCACCTACTAAGCAGAA
            Chromosome:
            7:92635096
            Gene:
            CDK6 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.3141/1573
            HGVS:
            NC_000007.13:g.92264410T>C, NC_000007.14:g.92635096T>C, NG_015888.1:g.206532A>G, NM_001145306.1:c.648-12010A>G, NM_001259.6:c.648-12010A>G, XM_006715835.2:c.648-12010A>G
            10.

            rs2061455 [Homo sapiens]
              aaattccacatgtggcttgcatttg[C/T]gtcttacattatgtttctgttgagc
              Chromosome:
              4:18033627
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.2542/1273
              HGVS:
              NC_000004.11:g.18035250A>G, NC_000004.12:g.18033627A>G
              11.

              rs1492820 [Homo sapiens]
                GCTTTAAAAACAACAATGCATTATA[C/T]AAACTAAATTTCGCCGAGGAATCAT
                Chromosome:
                4:144728869
                Gene:
                HHIP (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                G=0.4738/2373
                HGVS:
                NC_000004.11:g.145650021G>A, NC_000004.12:g.144728869G>A, NG_011496.1:g.87849G>A, NM_022475.2:c.1761-5872G>A, XM_005263178.1:c.1761-5872G>A, XM_005263178.4:c.1761-5872G>A, XM_006714288.3:c.1761-5872G>A
                12.

                rs1492819 [Homo sapiens]
                  AGATGAGCTTGTGTCCCAACAGCAT[C/T]TGAAAATTGTATATGCAGTTATGCA
                  Chromosome:
                  4:144698261
                  Gene:
                  HHIP (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  C=0.4864/2436
                  HGVS:
                  NC_000004.11:g.145619413T>C, NC_000004.12:g.144698261T>C, NG_011496.1:g.57241T>C, NM_022475.2:c.832-8270T>C, XM_005263178.1:c.832-8270T>C, XM_005263178.4:c.832-8270T>C, XM_006714288.3:c.832-8270T>C
                  13.

                  rs1042725 [Homo sapiens]
                    TCAATACTACCTCTGAATGTTACAA[C/T]GAATTTACAGTCTAGTACTTATTAC
                    Chromosome:
                    12:65964567
                    Gene:
                    HMGA2 (GeneView)
                    Functional Consequence:
                    utr variant 3 prime
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.4175/2091
                    HGVS:
                    NC_000012.11:g.66358347C>T, NC_000012.12:g.65964567C>T, NG_016296.1:g.145108C>T, NM_003483.4:c.*1275C>T
                    15.

                    rs143384 [Homo sapiens]
                      TTTCCTGCCAAACCAGAGGCACCTT[C/T]GCTGCTGCCGCTGTTCTCTTTGGTG
                      Chromosome:
                      20:35437976
                      Gene:
                      GDF5 (GeneView)
                      Functional Consequence:
                      utr variant 5 prime
                      Clinical significance:
                      Benign
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.4389/2198
                      HGVS:
                      NC_000020.10:g.34025756A>G, NC_000020.11:g.35437976G, NC_000020.11:g.35437976G>A, NG_008076.3:g.21771C, NG_008076.3:g.21771C>T, NM_000557.4:c.-48C, NM_000557.4:c.-48C>T, NM_001319138.1:c.-48C, NM_001319138.1:c.-48C>T, XM_011529075.2:c.-48C, XM_011529075.2:c.-48C>T
                      16.

                      rs143383 [Homo sapiens]
                        AGTTGTGCAGGAGAAAGGGGGCGGT[C/T]GGCTTTCTCCTTTCAAGAACGAGTT
                        Chromosome:
                        20:35438203
                        Gene:
                        GDF5 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Clinical significance:
                        other
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.4535/2271
                        HGVS:
                        NC_000020.10:g.34025983A>G, NC_000020.11:g.35438203G, NC_000020.11:g.35438203G>A, NG_008076.3:g.21544C, NG_008076.3:g.21544C>T, NM_000557.3:c.-275C, NM_000557.3:c.-275C>T, NM_000557.4:c.-275C, NM_000557.4:c.-275C>T, NM_000557.4:c.-275T>C, NM_001319138.1:c.-241-34C, NM_001319138.1:c.-241-34C>T, NM_001319138.1:c.-241-34T>C, XM_011529075.2:c.-241-34C, XM_011529075.2:c.-241-34C>T

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center