Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 11

1.

rs281875372 [Homo sapiens]
    TACTAGGCCATGAACTGGGGCACTG[A/C/G]AAGTTGGGACATACAGTCAAAAATA
    Chromosome:
    1:40285990
    Gene:
    ZMPSTE24 (GeneView)
    Functional Consequence:
    nc transcript variant,stop gained
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    untested
    Validated:
    by cluster,by frequency
    HGVS:
    CM000663.2:g.40285990G>A, NC_000001.10:g.40751662G>A, NC_000001.10:g.40751662G>C, NC_000001.11:g.40285990G>A, NG_008695.1:g.32930G>A, NG_008695.1:g.32930G>C, NM_005857.3:c.1020G>A, NM_005857.3:c.1020G>C, NM_005857.4:c.1020G>A, NM_005857.4:c.1020G>C, NP_005848.2:p.Trp340Cys, NP_005848.2:p.Trp340Ter, XP_005270405.1:p.Trp257Cys, XP_005270405.1:p.Trp257Ter, XR_001736906.1:n.1435G>A
    3.

    rs16827109 [Homo sapiens]
      TGTCTCTGGTGAGTAAAATCTTTAT[G/T]TCGTTTTCTTTTGCAAAAGTTCCTT
      Chromosome:
      1:40270145
      Gene:
      ZMPSTE24 (GeneView)
      Functional Consequence:
      intron variant
      Allele Origin:
      G(germline)/T(germline)
      Clinical significance:
      untested
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.1154/578
      HGVS:
      CM000663.2:g.40270145T>G, NC_000001.10:g.40735817T>G, NC_000001.11:g.40270145T>G, NG_008695.1:g.17085T>G, NM_005857.3:c.627+18T>G, NM_005857.4:c.627+18T>G, XR_001736906.1:n.849+18T>G
      4.

      rs9326050 [Homo sapiens]
        aaattttgaaaaagtgtttacccct[C/T]atatatttaagttggtatctaactg
        Chromosome:
        1:40256236
        Gene:
        ZMPSTE24 (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3622/1814
        HGVS:
        CM000663.2:g.40256236T>C, NC_000001.10:g.40721908T>C, NC_000001.11:g.40256236T>C, NG_008695.1:g.3176T>C, NM_005857.4:c.-2036T>C, XR_001736906.1:n.-1814T>C
        5.

        rs7548758 [Homo sapiens]
          GGGCCACCATTAATTTTGTTGAAAG[C/G]AAAGAACTGGAAACCATCTGACTTG
          Chromosome:
          1:40257003
          Gene:
          ZMPSTE24 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Allele Origin:
          G(germline)/C(germline)
          Clinical significance:
          untested
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          G=0.1310/656
          HGVS:
          CM000663.2:g.40257003C>G, NC_000001.10:g.40722675C>G, NC_000001.11:g.40257003C>G, NG_008695.1:g.3943C>G, NM_005857.4:c.-1269C>G, NM_005857.4:c.-211-1058C>G, XR_001736906.1:n.-1047C>G
          6.

          rs6677717 [Homo sapiens]
            AATTTAATCTGTATAATAAAGAATG[C/G/T]TTTTTCTTTAAGAACATGTTCATAT
            Chromosome:
            1:40271844
            Gene:
            ZMPSTE24 (GeneView)
            Functional Consequence:
            intron variant
            Allele Origin:
            G(germline)/T(germline)/C(germline)
            Clinical significance:
            untested
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.0068/34
            HGVS:
            CM000663.2:g.40271844T>G, NC_000001.10:g.40737516T>C, NC_000001.10:g.40737516T>G, NC_000001.11:g.40271844T>C, NC_000001.11:g.40271844T>G, NG_008695.1:g.18784T>C, NG_008695.1:g.18784T>G, NM_005857.3:c.628-50T>G, NM_005857.4:c.628-50T>C, NM_005857.4:c.628-50T>G, XR_001736906.1:n.850-50T>C, XR_001736906.1:n.850-50T>G
            7.

            rs3775483 [Homo sapiens]
              TCTAATTTTTTCCACAGTTTCTTAA[A/G]TTCTCCTTATAGCACAGCTTTGATC
              Chromosome:
              4:89949208
              Gene:
              MMRN1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2967/1486
              HGVS:
              CM000666.2:g.89949208G>A, NC_000004.11:g.90870359G>A, NC_000004.12:g.89949208G>A, NG_032895.2:g.74677G>A, NM_007351.2:c.3119-2397G>A
              8.

              rs2485662 [Homo sapiens]
                CAGGGCTGGGGGCTGGACAGCCAAT[A/G]TTGGGTCTCTATCCTGGTTTCAGCC
                Chromosome:
                1:156113677
                Gene:
                LMNA (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.3079/1542
                HGVS:
                CM000663.2:g.156113677T>C, NC_000001.10:g.156083468T>C, NC_000001.11:g.156113677T>C, NG_008692.2:g.36105T>C, NM_001282625.1:c.-206-1036T>C, NM_001282626.1:c.-1242T>C, NM_005572.3:c.-1242T>C, NM_170707.3:c.-1242T>C, NM_170708.3:c.-1242T>C, NR_047544.1:n.436-1036T>C, XR_921781.1:n.-993T>C
                9.

                rs2485661 [Homo sapiens]
                  GGTTCCCAGAGGGGCCTGAAAGGGG[A/G]AGCAGGGCTGGGGGCTGGACAGCCA
                  Chromosome:
                  1:156113705
                  Gene:
                  LMNA (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.1348/675
                  HGVS:
                  CM000663.2:g.156113705T>C, NC_000001.10:g.156083496T>C, NC_000001.11:g.156113705T>C, NG_008692.2:g.36133T>C, NM_001282625.1:c.-206-1008T>C, NM_001282626.1:c.-1214T>C, NM_005572.3:c.-1214T>C, NM_170707.3:c.-1214T>C, NM_170708.3:c.-1214T>C, NR_047544.1:n.436-1008T>C, XR_921781.1:n.-965T>C
                  10.

                  rs2076697 [Homo sapiens]
                    AGGTTCTTGTCACAATCTATGCTGA[C/T]TATATTGCCCCTTTATTTGACAAAT
                    Chromosome:
                    1:40271917
                    Gene:
                    ZMPSTE24 (GeneView)
                    Functional Consequence:
                    nc transcript variant,synonymous codon
                    Allele Origin:
                    T(germline)/C(germline)
                    Clinical significance:
                    other
                    Validated:
                    by 1000G,by cluster,by frequency,by submitter
                    Global MAF:
                    C=0.1278/640
                    HGVS:
                    CM000663.2:g.40271917T>C, NC_000001.10:g.40737589T>C, NC_000001.11:g.40271917T>C, NG_008695.1:g.18857T>C, NM_005857.3:c.651T>C, NM_005857.4:c.651T>C, NP_005848.2:p.Asp217, XP_005270405.1:p.Asp134, XR_001736906.1:n.873T>C

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center