Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs10503929 [Homo sapiens]
    AGCCTTCGGTCTGAACGAAACAATA[C/T]GATGAACATTGCCAATGGGCCTCAC
    Chromosome:
    8:32756465
    Gene:
    NRG1 (GeneView)
    Functional Consequence:
    missense
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0673/337
    HGVS:
    NC_000008.10:g.32613983T>C, NC_000008.11:g.32756465T>C, NG_012005.1:g.1121716T>C, NM_001159995.2:c.767T>C, NM_001159996.2:c.404T>C, NM_001159999.2:c.818T>C, NM_001160001.2:c.716T>C, NM_001160004.2:c.857T>C, NM_001160008.1:c.857T>C, NM_001322197.1:c.395T>C, NM_001322201.1:c.92T>C, NM_001322202.1:c.92T>C, NM_001322203.1:c.767T>C, NM_001322205.1:c.1046T>C, NM_001322206.1:c.1046T>C, NM_001322207.1:c.1046T>C, NM_013956.4:c.881T>C, NM_013957.4:c.857T>C, NM_013960.4:c.866T>C, NM_013964.4:c.866T>C, NP_001153467.1:p.Met256Thr, NP_001153468.1:p.Met135Thr, NP_001153471.1:p.Met273Thr, NP_001153473.1:p.Met239Thr, NP_001153476.1:p.Met286Thr, NP_001153480.1:p.Met286Thr, NP_001309126.1:p.Met132Thr, NP_001309130.1:p.Met31Thr, NP_001309131.1:p.Met31Thr, NP_001309132.1:p.Met256Thr, NP_001309134.1:p.Met349Thr, NP_001309135.1:p.Met349Thr, NP_001309136.1:p.Met349Thr, NP_039250.2:p.Met294Thr, NP_039251.2:p.Met286Thr, NP_039254.1:p.Met289Thr, NP_039258.1:p.Met289Thr, XM_005273485.1:c.1046T>C, XM_005273486.1:c.1031T>C, XM_005273486.3:c.1031T>C, XM_005273487.1:c.1022T>C, XM_005273487.3:c.1022T>C, XM_005273488.1:c.851T>C, XM_005273489.1:c.395T>C, XM_006716335.3:c.206T>C, XM_011544512.2:c.902T>C, XM_017013365.1:c.887T>C, XM_017013366.1:c.878T>C, XM_017013367.1:c.800T>C, XM_017013368.1:c.779T>C, XM_017013369.1:c.419T>C, XM_017013370.1:c.404T>C, XM_017013371.1:c.887T>C, XM_017013372.1:c.878T>C, XP_005273542.1:p.Met349Thr, XP_005273543.1:p.Met344Thr, XP_005273544.1:p.Met341Thr, XP_005273545.1:p.Met284Thr, XP_005273546.1:p.Met132Thr, XP_006716398.1:p.Met69Thr, XP_011542814.1:p.Met301Thr, XP_016868854.1:p.Met296Thr, XP_016868855.1:p.Met293Thr, XP_016868856.1:p.Met267Thr, XP_016868857.1:p.Met260Thr, XP_016868858.1:p.Met140Thr, XP_016868859.1:p.Met135Thr, XP_016868860.1:p.Met296Thr, XP_016868861.1:p.Met293Thr
    2.

    rs6994992 [Homo sapiens]
      AAGCACCATGCAGGGTTCAAGTGAA[C/T]GTATACTGGAGGCCAGACCTGCCCA
      Chromosome:
      8:31638065
      Gene:
      NRG1 (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.4421/2214
      HGVS:
      NC_000008.10:g.31495581C>T, NC_000008.11:g.31638065C>T, NG_012005.1:g.3314C>T, NM_001159995.2:c.-1330C>T, NM_001159999.2:c.-1330C>T, NM_001160001.2:c.-1330C>T, NM_001322201.1:c.-1922C>T, NM_001322202.1:c.-1871C>T, NM_001322203.1:c.-1330C>T, NM_013962.2:c.-1920C>T
      3.

      rs3924999 [Homo sapiens]
        TTCCTGGCTTTTCATCTCTTTCAAT[C/T]GGGGAGGCAAGGCTAAAAGAAGAAA
        Chromosome:
        8:32595840
        Gene:
        NRG1 (GeneView)
        Functional Consequence:
        missense,utr variant 5 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3852/1929
        HGVS:
        NC_000008.10:g.32453358G>A, NC_000008.11:g.32595840G>A, NG_012005.1:g.961091G>A, NM_001159995.2:c.50G>A, NM_001159999.2:c.50G>A, NM_001160001.2:c.50G>A, NM_001160002.1:c.113G>A, NM_001160004.2:c.113G>A, NM_001160005.1:c.113G>A, NM_001160007.1:c.113G>A, NM_001160008.1:c.113G>A, NM_001322201.1:c.-543G>A, NM_001322202.1:c.-492G>A, NM_001322203.1:c.50G>A, NM_004495.3:c.113G>A, NM_013956.4:c.113G>A, NM_013957.4:c.113G>A, NM_013958.3:c.113G>A, NM_013960.4:c.113G>A, NM_013962.2:c.758G>A, NM_013964.4:c.113G>A, NP_001153467.1:p.Arg17Gln, NP_001153471.1:p.Arg17Gln, NP_001153473.1:p.Arg17Gln, NP_001153474.1:p.Arg38Gln, NP_001153476.1:p.Arg38Gln, NP_001153477.1:p.Arg38Gln, NP_001153479.1:p.Arg38Gln, NP_001153480.1:p.Arg38Gln, NP_001309132.1:p.Arg17Gln, NP_004486.2:p.Arg38Gln, NP_039250.2:p.Arg38Gln, NP_039251.2:p.Arg38Gln, NP_039252.2:p.Arg38Gln, NP_039254.1:p.Arg38Gln, NP_039256.2:p.Arg253Gln, NP_039258.1:p.Arg38Gln, XM_005273488.1:c.134G>A, XM_011544512.2:c.134G>A, XM_017013365.1:c.134G>A, XM_017013366.1:c.134G>A, XM_017013367.1:c.134G>A, XM_017013368.1:c.113G>A, XM_017013371.1:c.134G>A, XM_017013372.1:c.134G>A, XP_005273545.1:p.Arg45Gln, XP_011542814.1:p.Arg45Gln, XP_016868854.1:p.Arg45Gln, XP_016868855.1:p.Arg45Gln, XP_016868856.1:p.Arg45Gln, XP_016868857.1:p.Arg38Gln, XP_016868860.1:p.Arg45Gln, XP_016868861.1:p.Arg45Gln

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center