Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 132

1.

rs17806888 [Homo sapiens]
    AGTTTGCGTATTTAAAGGAGTTTCA[C/T]TGTTTGAAAACATGAATCAATCCCC
    Chromosome:
    3:67365898
    Gene:
    SUCLG2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0615/308
    HGVS:
    NC_000003.11:g.67416322T>C, NC_000003.12:g.67365898T>C, NM_001177599.1:c.1184-5130A>G, XM_017007415.1:c.1184-5130A>G, XM_017007416.1:c.1184-5130A>G, XM_017007417.1:c.1184-5130A>G, XM_017007418.1:c.1184-5130A>G, XM_017007419.1:c.1184-5130A>G, XR_001740349.1:n.1378-5130A>G
    2.

    rs17780086 [Homo sapiens]
    • Suspected
    TAATTCCTCCATTAAGGTAATAACC[A/G]ATCAGGTGGTCCAGAGTCTGTGTCA
    Chromosome:
    17:32016263
    Gene:
    LRRC37B (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0729/365
    HGVS:
    NC_000017.10:g.30343282G>A, NC_000017.11:g.32016263G>A, NM_001321350.1:c.-190-1709G>A
    10.

    rs12694997 [Homo sapiens]
      cacgtctggccTAATTTTTTTAATC[A/G]AATTTATTTTTGTAATGATAGATGC
      Chromosome:
      2:241323571
      Gene:
      SEPT2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1204/603
      HGVS:
      NC_000002.11:g.242262986G>A, NC_000002.12:g.241323571G>A, NM_001008491.2:c.-17-645G>A, NM_001008492.2:c.-17-645G>A, NM_001282972.1:c.89-645G>A, NM_001282973.1:c.-17-645G>A, NM_001321029.1:c.74-645G>A, NM_001321030.1:c.-17-645G>A, NM_001321031.1:c.-17-645G>A, NM_001321032.1:c.-17-645G>A, NM_001321033.1:c.-17-645G>A, NM_001321034.1:c.-17-645G>A, NM_001321035.1:c.-17-645G>A, NM_004404.4:c.-17-645G>A, NM_006155.2:c.-17-645G>A, XM_005247009.1:c.89-645G>A, XM_005247010.1:c.-17-645G>A, XM_005247011.1:c.-17-645G>A, XM_005247012.1:c.-17-645G>A, XM_005247013.1:c.-17-645G>A, XM_005247014.1:c.-111-2422G>A, XM_005247015.1:c.-534-645G>A, XM_011511237.1:c.-534-645G>A, XM_011511238.1:c.-397-645G>A, XM_011511240.1:c.-413-645G>A, XM_017004189.1:c.185-645G>A, XM_017004190.1:c.170-645G>A, XM_017004191.1:c.185-645G>A, XM_017004192.1:c.185-645G>A, XM_017004193.1:c.-17-645G>A, XM_017004194.1:c.-17-645G>A, XM_017004195.1:c.-17-645G>A, XM_017004196.1:c.-17-645G>A, XM_017004197.1:c.-17-645G>A, XM_017004198.1:c.-17-645G>A, XM_017004199.1:c.-17-645G>A, XM_017004200.1:c.-17-645G>A, XM_017004201.1:c.-17-645G>A, XM_017004202.1:c.-17-645G>A, XM_017004203.1:c.-17-645G>A, XM_017004204.1:c.-17-645G>A, XM_017004205.1:c.-17-645G>A, XM_017004206.1:c.-17-645G>A, XM_017004208.1:c.-939-645G>A, XM_017004209.1:c.-939-645G>A, XM_017004210.1:c.-818-645G>A, XM_017004211.1:c.-818-645G>A, XM_017004212.1:c.-802-645G>A, XM_017004213.1:c.185-645G>A
      11.

      rs12474201 [Homo sapiens]
        ACCATGTCTATTTAGTGTGATAAAT[A/G]TATGTGCAACCTGTTATAGGAGGTT
        Chromosome:
        2:46694146
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2350/1177
        HGVS:
        NC_000002.11:g.46921285G>A, NC_000002.12:g.46694146G>A
        12.

        rs12470505 [Homo sapiens]
          TTTCTAAGCTTCTTTTTCCCAGATA[G/T]CTTCCCACACCTCTATGCCCCCCAT
          Chromosome:
          2:219043647
          Gene:
          CFAP65 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.1931/967
          HGVS:
          NC_000002.11:g.219908369T>G, NC_000002.12:g.219043647T>G, NG_051336.1:g.2905A>C, XM_011510904.2:c.-2259A>C, XM_017003753.1:c.-2135A>C, XM_017003755.1:c.-2302A>C
          13.

          rs12153391 [Homo sapiens]
            CCAGGGCAGAGCTAAACCCATCCCC[A/C]ACTTTCCTGCATCTGCAGAAGCCAT
            Chromosome:
            5:171776434
            Gene:
            SMIM23 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2188/1096
            HGVS:
            NC_000005.10:g.171776434C>A, NC_000005.9:g.171203438C>A, XM_011534623.2:c.3+2476C>A, XM_011534624.2:c.3+2476C>A
            16.

            rs11684404 [Homo sapiens]
              CACGGTGATCTTGTTAAAATGCAGA[C/T]ACTCTCATTCAGGGAGTGTGGGGTG
              Chromosome:
              2:88625104
              Gene:
              EIF2AK3 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.3405/1705
              HGVS:
              NC_000002.11:g.88924622T>C, NC_000002.12:g.88625104T>C, NG_016424.1:g.7473A>G, NM_001313915.1:c.-504A>G, NM_004836.6:c.308+1863A>G, XM_017005376.1:c.-573+1863A>G, XR_939749.2:n.517+1863A>G
              17.

              rs11648796 [Homo sapiens]
                CCACCGCGCCTGGCCAGTTACATGT[A/G]TATCTGGCATCATATGGCCAGTTAC
                Chromosome:
                16:742190
                Gene:
                NARFL (GeneView)
                Functional Consequence:
                upstream variant 2KB
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.4613/2310
                HGVS:
                NC_000016.10:g.742190A>G, NC_000016.9:g.792190A>G, NM_001304799.1:c.-1593T>C, NM_022493.2:c.-1205T>C
                18.

                rs11599750 [Homo sapiens]
                  TTGCTATGTGATATTACACAAGTTT[C/T]TTTTATCTTCTCTAAGCCACAAATG
                  Chromosome:
                  10:100045685
                  Gene:
                  CPN1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.3351/1678
                  HGVS:
                  NC_000010.10:g.101805442C>T, NC_000010.11:g.100045685C>T, NG_012060.1:g.41201G>A, NM_001308.2:c.1230+3073G>A
                  19.

                  rs11118346 [Homo sapiens]
                    TTGCCTTTCTCAGGTGTAGTTAAAA[C/T]AGATGGCCAAAAAAGACTCAGCCAG
                    Chromosome:
                    1:219570377
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.4179/2093
                    HGVS:
                    NC_000001.10:g.219743719C>T, NC_000001.11:g.219570377C>T
                    20.

                    rs11107116 [Homo sapiens]
                      GCCTAAATCCTAATTATCCAGCTTG[G/T]AAGAGTCCCTGACATCTGAATTTAC
                      Chromosome:
                      12:93584728
                      Gene:
                      SOCS2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.1695/849
                      HGVS:
                      NC_000012.11:g.93978504G>T, NC_000012.12:g.93584728G>T, XM_011538929.1:c.592-960G>T, XM_011538935.1:c.591+9555G>T, XR_944810.1:n.1273-960G>T

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center