Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 31

1.

rs17484848 [Homo sapiens]
    GGTCTCTAAAGCATTTTTCTTCTTA[C/T]GGGGAAATAAATTGGGTAGTTTACC
    Chromosome:
    2:111142983
    Gene:
    BCL2L11 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0363/182
    HGVS:
    NC_000002.11:g.111900560T>C, NC_000002.12:g.111142983T>C, NG_029006.1:g.27070T>C, NM_001204106.1:c.125-7061T>C, NM_001204107.1:c.125-7061T>C, NM_001204108.1:c.395-7061T>C, NM_001204109.1:c.395-10797T>C, NM_001204110.1:c.125-7061T>C, NM_001204111.1:c.214+18844T>C, NM_001204112.1:c.215-10797T>C, NM_001204113.1:c.293+592T>C, NM_006538.4:c.215-7061T>C, NM_138621.4:c.395-7061T>C, NM_138622.3:c.395-7061T>C, NM_138623.3:c.215-7061T>C, NM_138624.3:c.395-1505T>C, NM_138625.3:c.*13-7061T>C, NM_138626.3:c.394+18844T>C, NM_138627.3:c.124+19114T>C, NM_207003.2:c.125-7061T>C, XM_005263550.1:c.677-7061T>C, XM_005263550.3:c.677-7061T>C, XM_005263551.1:c.677-7061T>C, XM_005263551.2:c.677-7061T>C, XM_005263552.1:c.497-7061T>C, XM_005263552.3:c.497-7061T>C, XM_005263553.1:c.497-7061T>C, XM_005263553.2:c.497-7061T>C, XM_005263554.1:c.676+18844T>C, XM_005263554.2:c.676+18844T>C, XM_005263555.1:c.407-7061T>C, XM_005263555.3:c.407-7061T>C, XM_005263556.1:c.395-7061T>C, XM_005263556.3:c.395-7061T>C, XM_005263557.1:c.395-7061T>C, XM_005263557.4:c.395-7061T>C, XM_005263559.1:c.407-7061T>C, XM_005263559.2:c.407-7061T>C, XM_005263560.1:c.496+18844T>C, XM_005263561.1:c.215-7061T>C, XM_005263561.3:c.215-7061T>C, XM_017003101.1:c.496+18844T>C, XM_017003102.1:c.125-7061T>C, XR_001738579.1:n.1461-1505T>C, XR_001738580.1:n.1281-7061T>C, XR_244801.1:n.736-7061T>C, XR_244801.2:n.1461-7061T>C, XR_244802.1:n.736-7061T>C, XR_244803.1:n.556-7061T>C, XR_244804.1:n.466-7061T>C, XR_244805.1:n.683-7061T>C, XR_244806.1:n.683-7061T>C, XR_244807.1:n.683-10797T>C, XR_244808.1:n.683-1505T>C, XR_244809.1:n.503-7061T>C, XR_244810.1:n.413-7061T>C, XR_244811.1:n.503-10797T>C, XR_244812.1:n.413-7061T>C, XR_922828.2:n.1461-7061T>C, XR_922829.2:n.1461-7061T>C
    2.

    rs17041883 [Homo sapiens]
      GTGTCCAGAATCCAACAGGACAGAT[A/C]ATTTCTGATGGGTATGGAGACATCT
      Chromosome:
      2:111152165
      Gene:
      BCL2L11 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1226/614
      HGVS:
      NC_000002.11:g.111909742C>A, NC_000002.12:g.111152165C>A, NG_029006.1:g.36252C>A, NM_001204106.1:c.228+2018C>A, NM_001204107.1:c.*42+272C>A, NM_001204108.1:c.498+2018C>A, NM_001204109.1:c.395-1615C>A, NM_001204110.1:c.228+2018C>A, NM_001204111.1:c.215-11968C>A, NM_001204112.1:c.215-1615C>A, NM_006538.4:c.318+2018C>A, NM_138621.4:c.498+2018C>A, NM_138622.3:c.499-1615C>A, NM_138623.3:c.319-1615C>A, NM_138624.3:c.*123+2018C>A, NM_138625.3:c.*116+2018C>A, NM_138626.3:c.395-11968C>A, NM_138627.3:c.125-11968C>A, NM_207003.2:c.229-1615C>A, XM_005263551.1:c.780+2018C>A, XM_005263551.2:c.780+2018C>A, XM_005263553.1:c.600+2018C>A, XM_005263553.2:c.600+2018C>A, XM_005263554.1:c.677-11968C>A, XM_005263554.2:c.677-11968C>A, XM_005263559.1:c.510+2018C>A, XM_005263559.2:c.510+2018C>A, XM_005263560.1:c.497-11968C>A, XM_017003101.1:c.497-11968C>A, XR_001738579.1:n.1597+2018C>A, XR_001738580.1:n.1385-1615C>A, XR_244801.1:n.840-1615C>A, XR_244801.2:n.1565-1615C>A, XR_244802.1:n.840-1615C>A, XR_244803.1:n.660-1615C>A, XR_244804.1:n.570-1615C>A, XR_244805.1:n.786+2018C>A, XR_244806.1:n.787-1615C>A, XR_244807.1:n.683-1615C>A, XR_244808.1:n.819+2018C>A, XR_244809.1:n.607-1615C>A, XR_244810.1:n.516+2018C>A, XR_244811.1:n.503-1615C>A, XR_244812.1:n.517-1615C>A, XR_922828.2:n.1564+2018C>A, XR_922829.2:n.1565-1615C>A
      4.

      rs12613243 [Homo sapiens]
        CTGGCACGCAGCTCTCCTCCTGTTC[C/T]GCCTTTCTGTGTGGACCACGAGGCA
        Chromosome:
        2:111139929
        Gene:
        BCL2L11 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.1044/523
        HGVS:
        NC_000002.11:g.111897506T>C, NC_000002.12:g.111139929T>C, NG_029006.1:g.24016T>C, NM_001204106.1:c.125-10115T>C, NM_001204107.1:c.125-10115T>C, NM_001204108.1:c.395-10115T>C, NM_001204109.1:c.395-13851T>C, NM_001204110.1:c.125-10115T>C, NM_001204111.1:c.214+15790T>C, NM_001204112.1:c.215-13851T>C, NM_001204113.1:c.215-2384T>C, NM_006538.4:c.215-10115T>C, NM_138621.4:c.395-10115T>C, NM_138622.3:c.395-10115T>C, NM_138623.3:c.215-10115T>C, NM_138624.3:c.395-4559T>C, NM_138625.3:c.*12+9682T>C, NM_138626.3:c.394+15790T>C, NM_138627.3:c.124+16060T>C, NM_207003.2:c.125-10115T>C, XM_005263550.1:c.677-10115T>C, XM_005263550.3:c.677-10115T>C, XM_005263551.1:c.677-10115T>C, XM_005263551.2:c.677-10115T>C, XM_005263552.1:c.497-10115T>C, XM_005263552.3:c.497-10115T>C, XM_005263553.1:c.497-10115T>C, XM_005263553.2:c.497-10115T>C, XM_005263554.1:c.676+15790T>C, XM_005263554.2:c.676+15790T>C, XM_005263555.1:c.407-10115T>C, XM_005263555.3:c.407-10115T>C, XM_005263556.1:c.395-10115T>C, XM_005263556.3:c.395-10115T>C, XM_005263557.1:c.395-10115T>C, XM_005263557.4:c.395-10115T>C, XM_005263559.1:c.407-10115T>C, XM_005263559.2:c.407-10115T>C, XM_005263560.1:c.496+15790T>C, XM_005263561.1:c.215-10115T>C, XM_005263561.3:c.215-10115T>C, XM_005263562.1:c.215-2384T>C, XM_017003101.1:c.496+15790T>C, XM_017003102.1:c.125-10115T>C, XR_001738579.1:n.1461-4559T>C, XR_001738580.1:n.1281-10115T>C, XR_244801.1:n.736-10115T>C, XR_244801.2:n.1461-10115T>C, XR_244802.1:n.736-10115T>C, XR_244803.1:n.556-10115T>C, XR_244804.1:n.466-10115T>C, XR_244805.1:n.683-10115T>C, XR_244806.1:n.683-10115T>C, XR_244807.1:n.683-13851T>C, XR_244808.1:n.683-4559T>C, XR_244809.1:n.503-10115T>C, XR_244810.1:n.413-10115T>C, XR_244811.1:n.503-13851T>C, XR_244812.1:n.413-10115T>C, XR_922828.2:n.1461-10115T>C, XR_922829.2:n.1461-10115T>C
        6.

        rs7567444 [Homo sapiens]
          TAGCACCTGAACACATTTCTGGCTT[C/G/T]CATAGTTTCTAATGAAAATCTGCTG
          Chromosome:
          2:111105861
          Gene:
          ACOXL-AS1 (GeneView) ACOXL (GeneView)
          Functional Consequence:
          intron variant,utr variant 3 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.4575/2291
          HGVS:
          NC_000002.11:g.111863438T>C, NC_000002.12:g.111105861T>C, NC_000002.12:g.111105861T>G, NM_001142807.1:c.1543-11755T>C, NM_001142807.1:c.1543-11755T>G, NR_122074.1:n.230-3785A>C, NR_122074.1:n.230-3785A>G, XM_011511404.2:c.1633-11755T>C, XM_011511404.2:c.1633-11755T>G, XM_011511405.2:c.1633-11755T>C, XM_011511405.2:c.1633-11755T>G, XM_011511406.2:c.1633-11755T>C, XM_011511406.2:c.1633-11755T>G, XM_011511407.2:c.1621-11755T>C, XM_011511407.2:c.1621-11755T>G, XM_011511409.1:c.1633-11084T>C, XM_011511409.1:c.1633-11084T>G, XM_011511411.2:c.1516-11755T>C, XM_011511411.2:c.1516-11755T>G, XM_011511413.1:c.1633-8247T>C, XM_011511413.1:c.1633-8247T>G, XM_011511414.2:c.1474-11755T>C, XM_011511414.2:c.1474-11755T>G, XM_011511415.2:c.*1782T>C, XM_011511415.2:c.*1782T>G, XM_011511420.2:c.*41-11755T>C, XM_011511420.2:c.*41-11755T>G, XM_011511421.2:c.*1849T>C, XM_011511421.2:c.*1849T>G, XM_011511422.1:c.*41-11084T>C, XM_011511422.1:c.*41-11084T>G, XM_011511432.2:c.1633-11755T>C, XM_011511432.2:c.1633-11755T>G, XM_011511434.2:c.772-11755T>C, XM_011511434.2:c.772-11755T>G, XM_017004433.1:c.904-11755T>C, XM_017004433.1:c.904-11755T>G, XM_017004434.1:c.772-11755T>C, XM_017004434.1:c.772-11755T>G, XR_001738823.1:n.1691-11755T>C, XR_001738823.1:n.1691-11755T>G, XR_109903.2:n.48-3785A>G, XR_922958.1:n.1891-11084T>C, XR_922958.1:n.1891-11084T>G
          7.

          rs6760053 [Homo sapiens]
            GCAAAATGTGGCAAAATGGTAACAT[C/G]TGGGTACTCTGGGTAAAGGCTATAA
            Chromosome:
            2:111175420
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3534/1770
            HGVS:
            NC_000002.11:g.111932997C>G, NC_000002.12:g.111175420C>G
            8.

            rs6753785 [Homo sapiens]
              ATTTTTAAAGCTGTGTTGGAGCTCA[C/G/T]CTTGTTCCCTGATGTGTCTCGAGCC
              Chromosome:
              2:111166053
              Gene:
              BCL2L11 (GeneView)
              Functional Consequence:
              nc transcript variant,utr variant 3 prime
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.4858/2433
              HGVS:
              NC_000002.11:g.111923630T>G, NC_000002.12:g.111166053T>C, NC_000002.12:g.111166053T>G, NG_029006.1:g.50140T>C, NG_029006.1:g.50140T>G, NM_001204106.1:c.*1822T>C, NM_001204106.1:c.*1822T>G, NM_001204107.1:c.*2088T>C, NM_001204107.1:c.*2088T>G, NM_001204108.1:c.*2032T>C, NM_001204108.1:c.*2032T>G, NM_001204109.1:c.*2017T>C, NM_001204109.1:c.*2017T>G, NM_001204110.1:c.*2032T>C, NM_001204110.1:c.*2032T>G, NM_001204111.1:c.*1907T>C, NM_001204111.1:c.*1907T>G, NM_001204112.1:c.*2017T>C, NM_001204112.1:c.*2017T>G, NM_006538.4:c.*1822T>C, NM_006538.4:c.*1822T>G, NM_138621.4:c.*1822T>C, NM_138621.4:c.*1822T>G, NM_138622.3:c.*2034T>C, NM_138622.3:c.*2034T>G, NM_138623.3:c.*2034T>C, NM_138623.3:c.*2034T>G, NM_138624.3:c.*2044T>C, NM_138624.3:c.*2044T>G, NM_138625.3:c.*2037T>C, NM_138625.3:c.*2037T>G, NM_138626.3:c.*1907T>C, NM_138626.3:c.*1907T>G, NM_138627.3:c.*1907T>C, NM_138627.3:c.*1907T>G, NM_207003.2:c.*2034T>C, NM_207003.2:c.*2034T>G, XM_005263551.1:c.*1822T>G, XM_005263551.2:c.*1822T>C, XM_005263551.2:c.*1822T>G, XM_005263553.1:c.*1822T>G, XM_005263553.2:c.*1822T>C, XM_005263553.2:c.*1822T>G, XM_005263554.1:c.*1907T>G, XM_005263554.2:c.*1907T>C, XM_005263554.2:c.*1907T>G, XM_005263559.1:c.*1822T>G, XM_005263559.2:c.*1822T>C, XM_005263559.2:c.*1822T>G, XM_005263560.1:c.*1907T>G, XM_017003101.1:c.*1907T>C, XM_017003101.1:c.*1907T>G, XR_001738580.1:n.3430T>C, XR_001738580.1:n.3430T>G, XR_244801.1:n.2885T>G, XR_244801.2:n.3610T>C, XR_244801.2:n.3610T>G, XR_244803.1:n.2705T>G, XR_244804.1:n.2615T>G, XR_244805.1:n.2839T>G, XR_244806.1:n.2832T>G, XR_244807.1:n.2728T>G, XR_244808.1:n.2740T>G, XR_244809.1:n.2652T>G, XR_244810.1:n.2569T>G, XR_244811.1:n.2548T>G, XR_244812.1:n.2562T>G
              9.

              rs6746608 [Homo sapiens]
                TTATTGTGTCCAGTTGTTGGGGGAG[A/G/T]TGTGTAAGCTTGGCTCCCTCAGCCA
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.4940/2474
                HGVS:
                NC_000002.11:g.111892984A>G, NC_000002.11:g.111892984A>T, NG_029006.1:g.19494A>G, NG_029006.1:g.19494A>T, NM_001204106.1:c.124+11538A>G, NM_001204106.1:c.124+11538A>T, NM_001204107.1:c.124+11538A>G, NM_001204107.1:c.124+11538A>T, NM_001204108.1:c.394+11268A>G, NM_001204108.1:c.394+11268A>T, NM_001204109.1:c.394+11268A>G, NM_001204109.1:c.394+11268A>T, NM_001204110.1:c.124+11538A>G, NM_001204110.1:c.124+11538A>T, NM_001204111.1:c.214+11268A>G, NM_001204111.1:c.214+11268A>T, NM_001204112.1:c.214+11268A>G, NM_001204112.1:c.214+11268A>T, NM_001204113.1:c.215-6906A>G, NM_001204113.1:c.215-6906A>T, NM_006538.4:c.214+11268A>G, NM_006538.4:c.214+11268A>T, NM_138621.4:c.394+11268A>G, NM_138621.4:c.394+11268A>T, NM_138622.3:c.394+11268A>G, NM_138622.3:c.394+11268A>T, NM_138623.3:c.214+11268A>G, NM_138623.3:c.214+11268A>T, NM_138624.3:c.395-9081A>G, NM_138624.3:c.395-9081A>T, NM_138625.3:c.*12+5160A>G, NM_138625.3:c.*12+5160A>T, NM_138626.3:c.394+11268A>G, NM_138626.3:c.394+11268A>T, NM_138627.3:c.124+11538A>G, NM_138627.3:c.124+11538A>T, NM_207003.2:c.124+11538A>G, NM_207003.2:c.124+11538A>T, XM_005263550.1:c.676+11268A>G, XM_005263550.1:c.676+11268A>T, XM_005263551.1:c.676+11268A>G, XM_005263551.1:c.676+11268A>T, XM_005263552.1:c.496+11268A>G, XM_005263552.1:c.496+11268A>T, XM_005263553.1:c.496+11268A>G, XM_005263553.1:c.496+11268A>T, XM_005263554.1:c.676+11268A>G, XM_005263554.1:c.676+11268A>T, XM_005263555.1:c.406+11538A>G, XM_005263555.1:c.406+11538A>T, XM_005263556.1:c.394+11268A>G, XM_005263556.1:c.394+11268A>T, XM_005263557.1:c.394+11268A>G, XM_005263557.1:c.394+11268A>T, XM_005263559.1:c.406+11538A>G, XM_005263559.1:c.406+11538A>T, XM_005263560.1:c.496+11268A>G, XM_005263560.1:c.496+11268A>T, XM_005263561.1:c.214+11268A>G, XM_005263561.1:c.214+11268A>T, XM_005263562.1:c.215-6906A>G, XM_005263562.1:c.215-6906A>T, XR_244801.1:n.735+11268A>G, XR_244801.1:n.735+11268A>T, XR_244802.1:n.735+11268A>G, XR_244802.1:n.735+11268A>T, XR_244803.1:n.555+11268A>G, XR_244803.1:n.555+11268A>T, XR_244804.1:n.465+11538A>G, XR_244804.1:n.465+11538A>T, XR_244805.1:n.682+11268A>G, XR_244805.1:n.682+11268A>T, XR_244806.1:n.682+11268A>G, XR_244806.1:n.682+11268A>T, XR_244807.1:n.682+11268A>G, XR_244807.1:n.682+11268A>T, XR_244808.1:n.683-9081A>G, XR_244808.1:n.683-9081A>T, XR_244809.1:n.502+11268A>G, XR_244809.1:n.502+11268A>T, XR_244810.1:n.412+11538A>G, XR_244810.1:n.412+11538A>T, XR_244811.1:n.502+11268A>G, XR_244811.1:n.502+11268A>T, XR_244812.1:n.412+11538A>G, XR_244812.1:n.412+11538A>T
                10.

                rs6685648 [Homo sapiens]
                  ACTTCTGTCTTGCAAATACCAGATA[C/T]AGAACTATAGAACACCAGATTCCAT
                  Chromosome:
                  1:15498700
                  Gene:
                  CASP9 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.3462/1734
                  HGVS:
                  NC_000001.10:g.15825195T>C, NC_000001.11:g.15498700T>C, NG_029188.1:g.31091A>G, NM_001229.4:c.869-3248A>G, NM_001278054.1:c.419-3248A>G, NM_032996.3:c.620-3248A>G, NR_102732.1:n.1172-3248A>G, NR_102733.1:n.974-3248A>G, XM_005246013.1:c.869-3248A>G, XM_005246014.1:c.620-3248A>G, XM_005246014.2:c.620-3248A>G, XM_005246015.1:c.401-3248A>G, XM_011542273.2:c.869-3248A>G
                  11.
                  12.

                  rs4646092 [Homo sapiens]
                    GGTGAGAGAAAAGACCAGGGTATGA[A/G]TCCTGGTTCTGTCTTTTGCCCCTCT
                    Chromosome:
                    1:15495178
                    Gene:
                    CASP9 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.2358/1181
                    HGVS:
                    NC_000001.10:g.15821673C>T, NC_000001.11:g.15495178C>T, NG_029188.1:g.34613G>A, NM_001229.4:c.1048+95G>A, NM_001278054.1:c.598+95G>A, NM_032996.3:c.799+95G>A, NR_102732.1:n.1351+95G>A, NR_102733.1:n.1153+95G>A, XM_005246013.1:c.1048+95G>A, XM_005246014.1:c.799+95G>A, XM_005246014.2:c.799+95G>A, XM_005246015.1:c.580+95G>A, XM_011542273.2:c.1048+95G>A
                    13.
                    14.

                    rs4646047 [Homo sapiens]
                      TCTCATAATATGGTCCCTAGAGCTC[A/G]TGAAGAATGTGGACTCCCAGGCCCT
                      Chromosome:
                      1:15505288
                      Gene:
                      CASP9 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.4151/2079
                      HGVS:
                      NC_000001.10:g.15831783T>C, NC_000001.11:g.15505288T>C, NG_029188.1:g.24503A>G, NM_001229.4:c.721-530A>G, NM_001278054.1:c.419-9836A>G, NM_032996.3:c.472-530A>G, NR_102732.1:n.1024-530A>G, NR_102733.1:n.826-530A>G, XM_005246013.1:c.721-530A>G, XM_005246014.1:c.472-530A>G, XM_005246014.2:c.472-530A>G, XM_005246015.1:c.253-530A>G, XM_011542273.2:c.721-530A>G
                      15.
                      16.

                      rs3789068 [Homo sapiens]
                        TTTCTTGACTCTTACAGAAATTCCA[C/T]ACTGAAGAACTGATAGTGTCCTTTG
                        Chromosome:
                        2:111151670
                        Gene:
                        BCL2L11 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.3524/1765
                        HGVS:
                        NC_000002.11:g.111909247A>G, NC_000002.12:g.111151670A>G, NG_029006.1:g.35757A>G, NM_001204106.1:c.228+1523A>G, NM_001204107.1:c.229-152A>G, NM_001204108.1:c.498+1523A>G, NM_001204109.1:c.395-2110A>G, NM_001204110.1:c.228+1523A>G, NM_001204111.1:c.215-12463A>G, NM_001204112.1:c.215-2110A>G, NM_006538.4:c.318+1523A>G, NM_138621.4:c.498+1523A>G, NM_138622.3:c.498+1523A>G, NM_138623.3:c.318+1523A>G, NM_138624.3:c.*123+1523A>G, NM_138625.3:c.*116+1523A>G, NM_138626.3:c.395-12463A>G, NM_138627.3:c.125-12463A>G, NM_207003.2:c.228+1523A>G, XM_005263551.1:c.780+1523A>G, XM_005263551.2:c.780+1523A>G, XM_005263553.1:c.600+1523A>G, XM_005263553.2:c.600+1523A>G, XM_005263554.1:c.677-12463A>G, XM_005263554.2:c.677-12463A>G, XM_005263559.1:c.510+1523A>G, XM_005263559.2:c.510+1523A>G, XM_005263560.1:c.497-12463A>G, XM_017003101.1:c.497-12463A>G, XR_001738579.1:n.1597+1523A>G, XR_001738580.1:n.1384+1523A>G, XR_244801.1:n.839+1523A>G, XR_244801.2:n.1564+1523A>G, XR_244802.1:n.839+1523A>G, XR_244803.1:n.659+1523A>G, XR_244804.1:n.569+1523A>G, XR_244805.1:n.786+1523A>G, XR_244806.1:n.786+1523A>G, XR_244807.1:n.683-2110A>G, XR_244808.1:n.819+1523A>G, XR_244809.1:n.606+1523A>G, XR_244810.1:n.516+1523A>G, XR_244811.1:n.503-2110A>G, XR_244812.1:n.516+1523A>G, XR_922828.2:n.1564+1523A>G, XR_922829.2:n.1564+1523A>G
                        18.

                        rs3761704 [Homo sapiens]
                          GTAGTTTCAGCATTTATGAAAGCAC[C/T]TCACTCCATAAACCTGGCACTAAAT
                          Chromosome:
                          2:111146121
                          Gene:
                          BCL2L11 (GeneView)
                          Functional Consequence:
                          intron variant,utr variant 3 prime
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.1258/630
                          HGVS:
                          NC_000002.11:g.111903698A>G, NC_000002.12:g.111146121A>G, NG_029006.1:g.30208A>G, NM_001204106.1:c.125-3923A>G, NM_001204107.1:c.125-3923A>G, NM_001204108.1:c.395-3923A>G, NM_001204109.1:c.395-7659A>G, NM_001204110.1:c.125-3923A>G, NM_001204111.1:c.215-18012A>G, NM_001204112.1:c.215-7659A>G, NM_001204113.1:c.*202A>G, NM_006538.4:c.215-3923A>G, NM_138621.4:c.395-3923A>G, NM_138622.3:c.395-3923A>G, NM_138623.3:c.215-3923A>G, NM_138624.3:c.*19+1601A>G, NM_138625.3:c.*13-3923A>G, NM_138626.3:c.395-18012A>G, NM_138627.3:c.125-18012A>G, NM_207003.2:c.125-3923A>G, XM_005263550.1:c.677-3923A>G, XM_005263550.3:c.677-3923A>G, XM_005263551.1:c.677-3923A>G, XM_005263551.2:c.677-3923A>G, XM_005263552.1:c.497-3923A>G, XM_005263552.3:c.497-3923A>G, XM_005263553.1:c.497-3923A>G, XM_005263553.2:c.497-3923A>G, XM_005263554.1:c.677-18012A>G, XM_005263554.2:c.677-18012A>G, XM_005263555.1:c.407-3923A>G, XM_005263555.3:c.407-3923A>G, XM_005263556.1:c.395-3923A>G, XM_005263556.3:c.395-3923A>G, XM_005263557.1:c.395-3923A>G, XM_005263557.4:c.395-3923A>G, XM_005263559.1:c.407-3923A>G, XM_005263559.2:c.407-3923A>G, XM_005263560.1:c.497-18012A>G, XM_005263561.1:c.215-3923A>G, XM_005263561.3:c.215-3923A>G, XM_017003101.1:c.497-18012A>G, XM_017003102.1:c.125-3923A>G, XR_001738579.1:n.1493+1601A>G, XR_001738580.1:n.1281-3923A>G, XR_244801.1:n.736-3923A>G, XR_244801.2:n.1461-3923A>G, XR_244802.1:n.736-3923A>G, XR_244803.1:n.556-3923A>G, XR_244804.1:n.466-3923A>G, XR_244805.1:n.683-3923A>G, XR_244806.1:n.683-3923A>G, XR_244807.1:n.683-7659A>G, XR_244808.1:n.715+1601A>G, XR_244809.1:n.503-3923A>G, XR_244810.1:n.413-3923A>G, XR_244811.1:n.503-7659A>G, XR_244812.1:n.413-3923A>G, XR_922828.2:n.1461-3923A>G, XR_922829.2:n.1461-3923A>G
                          20.

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center