Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs2274700 [Homo sapiens]
    CATATCCTAGTTTGCATTGATATTT[C/T]GCTTTTTCTTTTAAGGCATATGTAT
    Chromosome:
    1:196713817
    Gene:
    CFH (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    other
    Validated:
    no info
    Global MAF:
    A=0.4790/2399
    HGVS:
    NC_000001.10:g.196682947G>A, NC_000001.10:g.196682947G>C, NC_000001.11:g.196713817G>A, NC_000001.11:g.196713817G>C, NG_007259.1:g.66807G>A, NG_007259.1:g.66807G>C, NM_000186.3:c.1419G>A, NM_000186.3:c.1419G>C, NP_000177.2:p.Ala473, XR_001737134.1:n.1541G>A, XR_001737134.1:n.1541G>C

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center