Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 45

1.

rs17753394 [Homo sapiens]
    GCAGCCTGTTTGTGAAATGAACCCG[G/T]GAACCTATGCCAGCCCCCGCTTGGT
    Chromosome:
    22:38282381
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.1426/714
    HGVS:
    CM000684.2:g.38282381T>G, NC_000022.10:g.38678387T>G
    2.

    rs17023218 [Homo sapiens]
      AGTTAATAAGTATGAATGAGATTAC[A/C]AAAAGTGAGGATATCAAGCTACAAT
      Chromosome:
      3:29301226
      Gene:
      RBMS3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.1951/977
      HGVS:
      CM000665.2:g.29301226C>A, NC_000003.11:g.29342717C>A, NC_000003.12:g.29301226C>A, NM_001003792.2:c.75+19470C>A, NM_001003793.2:c.75+19470C>A, NM_001177711.1:c.75+19470C>A, NM_001177712.1:c.75+19470C>A, NM_014483.3:c.75+19470C>A
      3.

      rs11953346 [Homo sapiens]
        GGCAGACTGGGAGGGCAGGGACTAT[C/T]ACCTTCCTTTTACAAAGGAGGAAAC
        Chromosome:
        5:94805742
        Gene:
        MCTP1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.1795/899
        HGVS:
        CM000667.2:g.94805742T>C, NC_000005.10:g.94805742T>C, NC_000005.9:g.94141447T>C, NM_001002796.3:c.1774-6610A>G, NM_001297777.1:c.1636-26579A>G, NM_024717.5:c.2437-6610A>G, XR_001742264.1:n.2080-6610A>G, XR_001742266.1:n.1799-6610A>G, XR_001742267.1:n.1760-6610A>G, XR_246546.1:n.2045-26579A>G
        4.

        rs11236388 [Homo sapiens]
          AACTTGATCCCCAGTAGTGACTCAA[C/T]ACAGGGAAGCTGACATTGTGCTATG
          Chromosome:
          11:75302748
          Gene:
          ARRB1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.0471/236
          HGVS:
          CM000673.2:g.75302748C>T, NC_000011.10:g.75302748C>T, NC_000011.9:g.75013792C>T, NG_028118.1:g.54084G>A, NM_004041.4:c.21-12709G>A, NM_020251.3:c.21-12709G>A
          5.

          rs11074889 [Homo sapiens]
            TGCCTGAAAACTCACTGGAGTGAAC[A/G/T]TAATTGGTAAGTACTTAATGAAACG
            Chromosome:
            16:10539308
            Gene:
            EMP2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.1841/922
            HGVS:
            CM000678.2:g.10539308A>G, CM000678.2:g.10539308A>T, NC_000016.10:g.10539308A>G, NC_000016.10:g.10539308A>T, NC_000016.9:g.10633165A>G, NG_042058.1:g.46409T>A, NG_042058.1:g.46409T>C, NM_001424.5:c.170-1234T>A, NM_001424.5:c.170-1234T>C
            6.

            rs10833716 [Homo sapiens]
              CAATTTAACAATTTTGGGACTGGAA[A/C]CTAGTGGGAAGAATTTGGGTTATAT
              Chromosome:
              11:22186181
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              C=0.4032/2019
              HGVS:
              CM000673.2:g.22186181A>C, NC_000011.9:g.22207727A>C
              7.

              rs10487524 [Homo sapiens]
                AAGCTGCAAAAGTAATCAGCAACCC[C/T]TTTTACAATATAAAATGAACTTTTC
                Chromosome:
                7:145144438
                Gene:
                LOC105375551 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                A=0.2280/1142
                HGVS:
                CM000669.2:g.145144438G>A, NC_000007.13:g.144841531G>A, NC_000007.14:g.145144438G>A, XR_928090.2:n.4143-12497G>A
                8.

                rs10120476 [Homo sapiens]
                  gttgaacaggtgatccagttctgac[C/T]attgagacatatggagaagttactg
                  Chromosome:
                  9:108237036
                  Gene:
                  LOC105376214 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  T=0.0439/220
                  HGVS:
                  CM000671.2:g.108237036C>T, NC_000009.11:g.110999316C>T, NC_000009.12:g.108237036C>T, XR_001746881.1:n.667+73630G>A, XR_001746882.1:n.667+73630G>A
                  9.

                  rs10011926 [Homo sapiens]
                    CACTGAAGAGGGAGTCTAGTCTACA[C/T]GGCAAACTAGTGTTCTGTTGAAATC
                    Chromosome:
                    4:110105771
                    Gene:
                    ELOVL6 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency
                    Global MAF:
                    T=0.4091/2049
                    HGVS:
                    CM000666.2:g.110105771C>T, NC_000004.11:g.111026927C>T, NC_000004.12:g.110105771C>T, NM_001130721.1:c.90-143G>A, NM_024090.2:c.90-143G>A
                    10.

                    rs9857832 [Homo sapiens]
                      CAAAAACTCTTATCTTTCAAGACTT[C/T]ACTCAAATGTGGCTACTTTGAAGTG
                      Chromosome:
                      3:143262038
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.3762/1884
                      HGVS:
                      CM000665.2:g.143262038T>C, NC_000003.11:g.142980880T>C
                      11.

                      rs9810857 [Homo sapiens]
                        GAAGTGAGTGGAAGTATGTGTGCAT[A/G]CACCCATGAATGTGTGTATGATATA
                        Chromosome:
                        3:143264057
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        G=0.2837/1421
                        HGVS:
                        CM000665.2:g.143264057A>G, NC_000003.11:g.142982899A>G, NC_000003.12:g.143264057A>G, NG_017077.1:g.589475T>C
                        12.

                        rs9757063 [Homo sapiens]
                          ATGAATGTGTGTATGATATACATGA[C/T]AGGAAGTTCAGGGAAGACCTGTAAG
                          Chromosome:
                          3:143264088
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.4046/2026
                          HGVS:
                          CM000665.2:g.143264088C>T, NC_000003.11:g.142982930C>T, NC_000003.12:g.143264088C>T, NG_017077.1:g.589444G>A
                          13.

                          rs9622773 [Homo sapiens]
                            CAAACAAGCGAACAAAAACAGGCTA[A/C]AGAGAAGGATTTCCTATCAGTTTTC
                            Chromosome:
                            22:38282740
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency
                            Global MAF:
                            A=0.1466/734
                            HGVS:
                            CM000684.2:g.38282740C>A, NC_000022.10:g.38678746C>A
                            14.

                            rs9350410 [Homo sapiens]
                              CTACTTGCTCTCTTCCCTTTGAAAC[A/G/T]TTATCCTATGCCTTCTTTATAATAT
                              Chromosome:
                              6:22032781
                              Gene:
                              CASC15 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.2778/1391
                              HGVS:
                              CM000668.2:g.22032781A>G, CM000668.2:g.22032781A>T, NC_000006.11:g.22033010A>G, NC_000006.12:g.22032781A>G, NC_000006.12:g.22032781A>T, NR_015410.1:n.1072+12239A>G, NR_015410.1:n.1072+12239A>T
                              16.

                              rs7702178 [Homo sapiens]
                                AAGTTCATTTCCGTAGAGCCTACAA[C/T]TGGAGACTCGGCTCCGTCAGACCAC
                                Chromosome:
                                5:172769994
                                Gene:
                                DUSP1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                C=0.2232/1118
                                HGVS:
                                CM000667.2:g.172769994T>C, NC_000005.10:g.172769994T>C, NC_000005.9:g.172196997T>C, NM_004417.3:c.513+167A>G
                                17.

                                rs6801526 [Homo sapiens]
                                  TATGTCTAGTTCTATTTACGTGAGC[A/G]TCTGCAGCTCCTTTCACTGAGAAGG
                                  Chromosome:
                                  3:143217030
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency
                                  Global MAF:
                                  A=0.1338/670
                                  HGVS:
                                  CM000665.2:g.143217030G>A, NC_000003.11:g.142935872G>A
                                  18.

                                  rs6781977 [Homo sapiens]
                                    cagggaaaacaacatgaaaccttag[A/G]gtttgagaataatcctctctggccc
                                    Chromosome:
                                    3:143206165
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency
                                    Global MAF:
                                    G=0.4179/2093
                                    HGVS:
                                    CM000665.2:g.143206165G>A, NC_000003.11:g.142925007G>A
                                    19.

                                    rs6561686 [Homo sapiens]
                                      gttacttattcaacatatggctata[C/T]tccttttactaatattttagtcaag
                                      Chromosome:
                                      13:52714959
                                      Gene:
                                      CNMD (GeneView) LECT1 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      C=0.0369/185
                                      HGVS:
                                      CM000675.2:g.52714959C>T, NC_000013.10:g.53289094C>T, NC_000013.11:g.52714959C>T, NM_001011705.1:c.469-2090G>A, NM_007015.2:c.469-2090G>A
                                      20.

                                      rs4923705 [Homo sapiens]
                                        CTCAAGAAAAGGCACTGGATGAAGT[A/G]CTGAGGTGTTGCTTCCTGAGAGTCA
                                        Chromosome:
                                        15:36001404
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        G=0.3708/1857
                                        HGVS:
                                        CM000677.2:g.36001404G>A, NC_000015.9:g.36293605G>A

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center