Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 35

1.

Error occurred: cannot get document summary

2.

rs17470528 [Homo sapiens]
    CAAGGAAGGTACCTGCATAGGATTG[C/T]CAGCTTTTTCTTAAGATTTTCATAT
    Chromosome:
    4:48049986
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.1310/656
    HGVS:
    CM000666.2:g.48049986T>C, NC_000004.11:g.48052003T>C
    3.

    rs17428448 [Homo sapiens]
      GGGTGAGGAGAAAAGGTACATGCAG[G/T]GACAGGAAAATAGCAAAAAAACAGT
      Chromosome:
      15:48259397
      Gene:
      SLC12A1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.0018/9
      HGVS:
      CM000677.2:g.48259397T>G, NC_000015.10:g.48259397T>G, NC_000015.9:g.48551594T>G, NG_021301.1:g.58097T>G, NM_000338.2:c.2154+86T>G, NM_001184832.1:c.2154+86T>G
      4.

      rs17348507 [Homo sapiens]
        GAGAACCAGGGTTAACAGTTTCCTT[A/G]GGTTTTCCTACCAAGTTGTGCTTCC
        Chromosome:
        1:205845607
        Gene:
        LOC107985250 (GeneView) PM20D1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.0465/233
        HGVS:
        CM000663.2:g.205845607A>G, NC_000001.10:g.205814735A>G, NC_000001.11:g.205845607A>G, NM_152491.4:c.257-50T>C, NR_135186.1:n.333-50T>C, XR_001738418.1:n.203+9304A>G, XR_241071.1:n.333-50T>C
        5.

        rs17251221 [Homo sapiens]
          TATAAATAAATGTTTGTCTAAAAAT[A/G]AAGTTAATACAGATATCAATTGTTA
          Chromosome:
          3:122274400
          Gene:
          CASR (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          G=0.0942/472
          HGVS:
          CM000665.2:g.122274400A>G, NC_000003.11:g.121993247A>G, NC_000003.12:g.122274400A>G, NG_009058.1:g.95718A>G, NM_000388.3:c.1378-1412A>G, NM_001178065.1:c.1378-1412A>G
          6.

          rs13146355 [Homo sapiens]
            CTTTGGAATATCTTCTGGGGTTAAC[A/G]GGGGAATTCTTGAAAGTTTTCTCAA
            Chromosome:
            4:76490987
            Gene:
            SHROOM3 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            A=0.2276/1140
            HGVS:
            CM000666.2:g.76490987G>A, NC_000004.11:g.77412140G>A, NC_000004.12:g.76490987G>A, NG_028077.1:g.60888G>A, NM_020859.3:c.168+54767G>A
            7.

            rs12681567 [Homo sapiens]
              cttccaaagttgtaagcaaacttat[A/C]ctttgttacaggggagacactacct
              Chromosome:
              8:15800094
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1388/695
              HGVS:
              CM000670.2:g.15800094C>A, NC_000008.10:g.15657603C>A
              8.

              rs11569033 [Homo sapiens]
                ATCTGTGTTCAGTTGAAAAAAATCC[A/G]GGTATAAGTGGACCTGTGCAGTTCA
                Chromosome:
                4:109984647
                Gene:
                EGF (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                G=0.0052/26
                HGVS:
                CM000666.2:g.109984647A>G, NC_000004.11:g.110905803A>G, NC_000004.12:g.109984647A>G, NG_011441.1:g.76764A>G, NM_001178130.2:c.2491+1106A>G, NM_001178131.2:c.2365+1106A>G, NM_001357021.1:c.2365+1106A>G, NM_001963.5:c.2491+1106A>G, XR_001741156.1:n.2968+1106A>G, XR_001741157.1:n.2968+1106A>G
                9.

                rs11144134 [Homo sapiens]
                  TCAAAAAAGACTAAGGTGTGGGATA[C/T]AGGAAACAGGAGCCAGCATAACAGA
                  Chromosome:
                  9:74884880
                  Gene:
                  TRPM6 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  C=0.0339/170
                  HGVS:
                  CM000671.2:g.74884880T>C, NC_000009.11:g.77499796T>C, NC_000009.12:g.74884880T>C, NG_017036.1:g.8215A>G, NM_001177310.1:c.18+2751A>G, NM_001177311.1:c.18+2351A>G, NM_017662.4:c.33+2944A>G, XR_001746185.1:n.271+2944A>G, XR_242568.1:n.271+2944A>G, XR_929717.2:n.271+2944A>G, XR_929718.1:n.271+2944A>G
                  10.

                  rs11134799 [Homo sapiens]
                    ATTTTAGGGGGATTCTATTCAACTC[A/G]TTGCAGGGGGTTGCAAAGATAACAT
                    Chromosome:
                    5:157531282
                    Gene:
                    ADAM19 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.0509/255
                    HGVS:
                    CM000667.2:g.157531282T>C, NC_000005.10:g.157531282T>C, NC_000005.9:g.156958290T>C, NG_046960.1:g.49542A>G, NM_033274.4:c.331-399A>G
                    11.

                    rs11115332 [Homo sapiens]
                      ATAGTATCCCACAGTATGGATGTAC[C/G/T]GTGATGTGTTAACCATTCACCCATT
                      Chromosome:
                      12:76777412
                      Gene:
                      ZDHHC17 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      G=0.1168/585
                      HGVS:
                      CM000674.2:g.76777412C>G, CM000674.2:g.76777412C>T, NC_000012.11:g.77171192C>G, NC_000012.12:g.76777412C>G, NC_000012.12:g.76777412C>T, NM_015336.2:c.93+13083C>G, NM_015336.2:c.93+13083C>T, XR_001748643.1:n.256+13083C>G, XR_001748643.1:n.256+13083C>T
                      12.

                      rs9990270 [Homo sapiens]
                        GAAAGAAAAGGTTATTTTTTTCTGG[C/G/T]AAGCGCTGTAGTAAATTTGTGTTTT
                        Chromosome:
                        3:190458817
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.4950/2479
                        HGVS:
                        CM000665.2:g.190458817C>G, CM000665.2:g.190458817C>T, NC_000003.11:g.190176606C>G
                        13.

                        rs9326034 [Homo sapiens]
                          CAAGTATTGGGCAAGTACTGGTGAT[A/G]TGAACTTACTCCTTGTGCCTATCCT
                          Chromosome:
                          1:55064991
                          Gene:
                          PCSK9 (GeneView)
                          Functional Consequence:
                          downstream variant 500B
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          A=0.0254/127
                          HGVS:
                          CM000663.2:g.55064991G>A, NC_000001.10:g.55530664G>A, NC_000001.11:g.55064991G>A, NG_009061.1:g.30445G>A, NM_174936.3:c.*1407G>A, NR_110451.1:n.3093G>A
                          14.

                          rs8048695 [Homo sapiens]
                            GAAGAGTGGAACACATGCTGTGTTC[A/G]TGAAGGCTTGTGATCACTGTTAAGA
                            Chromosome:
                            16:56877074
                            Gene:
                            SLC12A3 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency
                            Global MAF:
                            A=0.1593/798
                            HGVS:
                            CM000678.2:g.56877074G>A, NC_000016.10:g.56877074G>A, NC_000016.9:g.56910986G>A, NG_009386.1:g.16868G>A, NM_000339.2:c.1096-1003G>A, NM_001126107.1:c.1093-1003G>A, NM_001126108.1:c.1096-1003G>A
                            15.

                            rs7965584 [Homo sapiens]
                              AGTGGTGATGGTGATAAGTAAGTGC[A/G]TGTGTGTGTGTGTGTGTGTGTGTGT
                              Chromosome:
                              12:89912002
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency
                              Global MAF:
                              G=0.1631/817
                              HGVS:
                              CM000674.2:g.89912002A>G, NC_000012.11:g.90305779A>G
                              16.

                              rs7617162 [Homo sapiens]
                                TGTGGGTGTGAGTCCTGGGGTGCTT[C/T]GCTGCCTCTTCTTGGTTTCCTGAAT
                                Chromosome:
                                3:126036607
                                Gene:
                                SLC41A3 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                T=0.3255/1630
                                HGVS:
                                CM000665.2:g.126036607C>T, NC_000003.11:g.125755450C>T, NC_000003.12:g.126036607C>T, NM_001008485.1:c.382-2929G>A, NM_001008486.1:c.274-2929G>A, NM_001008487.1:c.304-2929G>A, NM_001164475.1:c.31-2929G>A, NM_017836.3:c.382-2929G>A
                                17.

                                rs7197653 [Homo sapiens]
                                  TCGTCGTTACTCCCACGGTCTCCCT[A/C/G]CAGGCTTCATCTGCTCTACCCGCTT
                                  Chromosome:
                                  16:68349144
                                  Gene:
                                  PRMT7 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by cluster,by frequency
                                  Global MAF:
                                  C=0.1831/917
                                  HGVS:
                                  CM000678.2:g.68349144G>A, CM000678.2:g.68349144G>C, NC_000016.10:g.68349144G>A, NC_000016.10:g.68349144G>C, NC_000016.9:g.68383047G>C, NG_054896.1:g.43171G>A, NG_054896.1:g.43171G>C, NM_001184824.1:c.1263+713G>C, NM_001184824.2:c.1263+713G>A, NM_001184824.2:c.1263+713G>C, NM_001290018.1:c.1413+713G>A, NM_001290018.1:c.1413+713G>C, NM_001351143.1:c.1413+713G>A, NM_001351143.1:c.1413+713G>C, NM_001351144.1:c.1413+713G>A, NM_001351144.1:c.1413+713G>C, NM_019023.2:c.1413+713G>C, NM_019023.3:c.1413+713G>A, NM_019023.3:c.1413+713G>C, NR_147056.1:n.1645+713G>A, NR_147056.1:n.1645+713G>C, NR_147057.1:n.1780+713G>A, NR_147057.1:n.1780+713G>C, NR_147058.1:n.1780+713G>A, NR_147058.1:n.1780+713G>C, XR_001751915.1:n.1749+713G>A, XR_001751915.1:n.1749+713G>C, XR_001751916.1:n.1749+713G>A, XR_001751916.1:n.1749+713G>C, XR_001751917.1:n.1689+713G>A, XR_001751917.1:n.1689+713G>C, XR_001751918.1:n.1689+713G>A, XR_001751918.1:n.1689+713G>C, XR_001751919.1:n.1749+713G>A, XR_001751919.1:n.1749+713G>C, XR_001751920.1:n.1683+713G>A, XR_001751920.1:n.1683+713G>C, XR_001751921.1:n.1517+713G>A, XR_001751921.1:n.1517+713G>C, XR_001751922.1:n.1517+713G>A, XR_001751922.1:n.1517+713G>C, XR_001751923.1:n.1683+713G>A, XR_001751923.1:n.1683+713G>C, XR_001751924.1:n.1566+713G>A, XR_001751924.1:n.1566+713G>C, XR_001751925.1:n.1424+713G>A, XR_001751925.1:n.1424+713G>C, XR_243413.1:n.1622+713G>A, XR_243413.1:n.1622+713G>C
                                  18.

                                  rs7116312 [Homo sapiens]
                                    GGGGTGAATAATAGCAGCTGGCTGA[A/G]TGCTCTTCAGGTATAGCCTCTTTAA
                                    Chromosome:
                                    11:19057745
                                    Gene:
                                    MRGPRX2 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency
                                    Global MAF:
                                    G=0.3241/1623
                                    HGVS:
                                    CM000673.2:g.19057745A>G, NC_000011.10:g.19057745A>G, NC_000011.9:g.19079292A>G, NM_001303615.1:c.-25-1318T>C, NM_054030.3:c.-25-1318T>C
                                    19.

                                    rs6746896 [Homo sapiens]
                                      TGGTCCCCTTTTTCTCTGTGGAATC[A/G]TCTATCTCCCACGATCTAGGGCTGC
                                      Chromosome:
                                      2:96745212
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency
                                      Global MAF:
                                      G=0.2143/1073
                                      HGVS:
                                      CM000664.2:g.96745212A>G, NC_000002.11:g.97410949A>G

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center