Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs9368570 [Homo sapiens]
    CAATGACTAAGTTAAAATGGAATAC[A/G]AAAAACATCAAAGACATCCAGAAAA
    Chromosome:
    6:28708416
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3618/1812
    HGVS:
    NC_000006.11:g.28676193G>A, NT_113891.2:g.198314G>A, NT_113891.3:g.198208G>A, NT_167249.1:g.17051G>A, NT_167249.2:g.16951A, NT_167249.2:g.16951A>G
    3.

    rs2736100 [Homo sapiens]
      ATTGTTTTCCGTGTTGAGTGTTTCT[G/T]TAGCTTTGCCCCCGCCCTGCTTTTC
      Chromosome:
      5:1286401
      Gene:
      TERT (GeneView)
      Functional Consequence:
      intron variant
      Clinical significance:
      other
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4846/2427
      HGVS:
      NC_000005.10:g.1286401C>A, NC_000005.9:g.1286516C>A, NG_009265.1:g.13647G>T, NM_001193376.1:c.1574-3777G>T, NM_198253.2:c.1574-3777G>T, XM_017009796.1:c.2204-3777G>T, XR_241712.1:n.1648-3777G>T, XR_241713.1:n.1648-3777G>T
      4.

      rs402710 [Homo sapiens]
        GGAGCAACGGCCGAGCATACGCAGC[C/T]GCACTCACCACCGCTGGTACAGGTA
        Chromosome:
        5:1320607
        Gene:
        CLPTM1L (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3359/1682
        HGVS:
        NC_000005.10:g.1320607C>T, NC_000005.9:g.1320722C>T, NG_046903.1:g.29459G>A, NM_030782.4:c.1532+9G>A, NT_187547.1:g.193402G>A, XM_005248379.1:c.1529+9G>A, XM_005248380.1:c.1424+9G>A, XM_011514144.2:c.1529+9G>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center