Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 31

1.

rs35408448 [Homo sapiens]
    ATTTAGTGAGAAAACATATTAAACA[C/G]CAAATAGTAGAATGATTAAAAATCA
    Chromosome:
    15:89807388
    Gene:
    ANPEP (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0465/233
    HGVS:
    NC_000015.10:g.89807388C>G, NC_000015.9:g.90350619C>G, NM_001150.2:c.-223-582G>C, XM_005254892.1:c.-226-579G>C, XM_005254892.4:c.-226-579G>C, XM_011521473.1:c.-362-443G>C
    2.

    rs35258303 [Homo sapiens]
      AGGAAGAATGCTATTTTGACAATGC[A/G]GAGGGGAAAACTGCTGAAGTTCTGT
      Chromosome:
      10:14834886
      Gene:
      CDNF (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0757/379
      HGVS:
      NC_000010.10:g.14876885G>A, NC_000010.11:g.14834886G>A, NM_001029954.2:c.115+2946C>T, XM_011519488.2:c.115+2946C>T
      3.

      rs17883018 [Homo sapiens]
        TTTGACTAAAGCAGACTTTCTCAGG[A/C]TTTTTAACCCTGACGCCTTCATGAT
        Chromosome:
        22:35382007
        Gene:
        HMOX1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        A=0.0230/115
        HGVS:
        NC_000022.10:g.35778000C>A, NC_000022.11:g.35382007C>A, NG_023030.1:g.5941C>A, NM_002133.2:c.23+811C>A
        4.

        rs17658295 [Homo sapiens]
          TGTACAAGTCACCTAGATCTTTGTC[A/G]TACTCTCCCCAGGTTCTAAGTTGGT
          Chromosome:
          5:172774971
          Gene:
          LOC105377730 (GeneView)
          Functional Consequence:
          intron variant,nc transcript variant,upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2712/1358
          HGVS:
          NC_000005.10:g.172774971G>A, NC_000005.9:g.172201974G>A, XR_001742998.1:n.219+1523G>A, XR_941230.1:n.1516G>A, XR_941231.1:n.1516G>A, XR_941232.2:n.82+2484G>A, XR_941233.2:n.88+2484G>A, XR_941234.2:n.-1594G>A, XR_941235.2:n.-1594G>A
          5.

          rs17134158 [Homo sapiens]
            GGCCATTGCAAAACCTTTCCTGACA[C/T]TCCTTCTTCCCCATCTTCCAGGATT
            Chromosome:
            10:5022974
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.2043/1023
            HGVS:
            NC_000010.10:g.5065166C>T, NC_000010.11:g.5022974C>T, NG_031852.1:g.42G>A, NW_003871071.1:g.52640C>T
            6.

            rs17047438 [Homo sapiens]
              AAAAACAAAACAGCATGAATAAGAC[C/T]TGTTCTATGTTAAACTTAATTATTT
              Chromosome:
              2:117811830
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.0743/372
              HGVS:
              NC_000002.11:g.118569406C>T, NC_000002.12:g.117811830C>T
              7.

              rs12414884 [Homo sapiens]
                TGCAGGAATCTGATGTCCATGTACG[G/T]GTATACACATTTGCATGTCTTTTTA
                Chromosome:
                10:5021206
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.3460/1733
                HGVS:
                NC_000010.10:g.5063398T>G, NC_000010.11:g.5021206T>G, NG_031852.1:g.1810A>C, NW_003871071.1:g.50872T>G
                9.

                rs10904392 [Homo sapiens]
                  GCTTTCGTTGCTTCTAGGCTGAGAA[G/T]TCAGGCACACAGGGGGCAGTCAATA
                  Chromosome:
                  10:5025921
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.4896/2452
                  HGVS:
                  NC_000010.10:g.5068113G>T, NC_000010.11:g.5025921G>T, NW_003871071.1:g.55587G>T
                  10.

                  rs10098474 [Homo sapiens]
                    GCAGGTCCTCTTCTATCTTACTGGG[C/T]ACTGCTAAACTGCGAAGTCGGGGCG
                    Chromosome:
                    8:10054107
                    Gene:
                    LOC105379234 (GeneView) LOC105379235 (GeneView) MSRA (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.3888/1947
                    HGVS:
                    NC_000008.10:g.9911617C>T, NC_000008.11:g.10054107C>T, NM_001135670.2:c.-410C>T, NM_012331.4:c.-410C>T, XM_011543822.1:c.-410C>T, XM_011543823.2:c.-410C>T, XM_017013448.1:c.-410C>T, XR_001745802.1:n.-1045G>A, XR_948944.2:n.-1045G>A, XR_948945.2:n.2116+819G>A
                    11.

                    rs10078827 [Homo sapiens]
                      AAGGCCAGGATCCCTCCCTGAAACA[G/T]CTTGCTCTCCTGGTCCTCTGCAGGT
                      Chromosome:
                      5:181245853
                      Gene:
                      CTC-338M12.4 (GeneView) RACK1 (GeneView)
                      Functional Consequence:
                      upstream variant 2KB
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.1791/897
                      HGVS:
                      NC_000005.10:g.181245853G>T, NC_000005.9:g.180672853G>T, NM_006098.4:c.-2053C>A, NR_109909.1:n.-688G>T, XM_005265790.1:c.-1819C>A, XM_005265791.1:c.-2188C>A, XM_005265792.1:c.-2195C>A, XR_245269.1:n.-1644C>A, XR_245313.1:n.-655G>T
                      12.

                      rs7037941 [Homo sapiens]
                        CCTACAAGTGAGGTAGAGCTCATAC[A/G/T]TCTAGCTCATGCTTGTCCTTGGGAG
                        Chromosome:
                        9:20536299
                        Gene:
                        MLLT3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.4798/2403
                        HGVS:
                        NC_000009.11:g.20536297T>G, NC_000009.12:g.20536299T>A, NC_000009.12:g.20536299T>G, NM_001286691.1:c.185-79513A>C, NM_001286691.1:c.185-79513A>T, NM_004529.3:c.194-79513A>C, NM_004529.3:c.194-79513A>T, XM_005251460.1:c.185-79513A>C, XM_017014726.1:c.194-79513A>C, XM_017014726.1:c.194-79513A>T, XM_017014727.1:c.185-79513A>C, XM_017014727.1:c.185-79513A>T
                        13.

                        rs6588537 [Homo sapiens]
                          TCCAGCTTCTAGCACGGTGCTTTGT[A/G]CACAGTAAACACTCCAGCGGCTGTT
                          Chromosome:
                          1:54888520
                          Gene:
                          DHCR24 (GeneView) LOC107984958 (GeneView)
                          Functional Consequence:
                          nc transcript variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.0679/340
                          HGVS:
                          NC_000001.10:g.55354193G>A, NC_000001.11:g.54888520G>A, NG_008839.1:g.3729C>T, NM_014762.3:c.-1401C>T, XM_005270553.1:c.-1795C>T, XR_001738059.1:n.811G>A
                          14.

                          rs4754450 [Homo sapiens]
                            gccagatgagtatcccgttgctaaa[C/T]aatgaggtcatgcttttgaggaaag
                            Chromosome:
                            11:110426324
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.4141/2074
                            HGVS:
                            NC_000011.10:g.110426324T>C, NC_000011.9:g.110297048T>C
                            15.

                            rs3810427 [Homo sapiens]
                              ATTTAGAGTCCAGTACACAGTAAAA[G/T]AACTTTGCATATTGTCTTTTGCAAA
                              Chromosome:
                              19:15935840
                              Gene:
                              CYP4F11 (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.3598/1802
                              HGVS:
                              NC_000019.10:g.15935840C>A, NC_000019.9:g.16046650C>A, NG_008335.1:g.4027G>T, NM_001128932.1:c.-1010G>T, NM_021187.3:c.-1432G>T
                              17.

                              rs3756273 [Homo sapiens]
                                GTGTTCTCCCAGCATGTTGCCATTT[C/T]ACCCCAGCAGTTCCTTTTCTGTCTT
                                Chromosome:
                                4:174524086
                                Gene:
                                HPGD (GeneView) LOC105377548 (GeneView)
                                Functional Consequence:
                                intron variant,nc transcript variant,upstream variant 2KB
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.4507/2257
                                HGVS:
                                NC_000004.11:g.175445237A>G, NC_000004.12:g.174524086A>G, NG_011689.1:g.3556T>C, NM_000860.5:c.-1635T>C, NM_001145816.2:c.-1635T>C, NM_001256301.1:c.-1733T>C, NM_001256305.1:c.-1635T>C, NM_001256306.1:c.-1635T>C, NM_001256307.1:c.-1891T>C, XM_011531907.1:c.-1635T>C, XR_001741921.1:n.126+665A>G, XR_001741922.1:n.123+665A>G, XR_001741923.1:n.86+1156A>G, XR_938728.1:n.-1193T>C, XR_939490.2:n.510A>G, XR_939491.2:n.246+665A>G
                                18.

                                rs3753660 [Homo sapiens]
                                  GTTTTTAAAATTCTCTTTGAATCTG[C/T]CACTTTGCCCTCCTCTTCCTGGGTG
                                  Chromosome:
                                  1:225825075
                                  Gene:
                                  EPHX1 (GeneView)
                                  Functional Consequence:
                                  intron variant,upstream variant 2KB
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.1240/621
                                  HGVS:
                                  NC_000001.10:g.226012776T>C, NC_000001.11:g.225825075T>C, NG_009776.1:g.19980T>C, NM_000120.3:c.-475T>C, NM_001136018.3:c.-5-3650T>C, NM_001291163.1:c.-5-3650T>C, XM_005273085.1:c.-5-3650T>C
                                  19.

                                  rs2658718 [Homo sapiens]
                                    gaatagttggagcagatataaaaat[C/T]tgagtcatcaactaatagatgggaa
                                    Chromosome:
                                    12:95470389
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    G=0.0895/448
                                    HGVS:
                                    NC_000012.11:g.95864165A>G, NC_000012.12:g.95470389A>G
                                    20.

                                    rs2397146 [Homo sapiens]
                                      ATCTCAGCCTCTGCTTACCAGGAAA[A/G]CACAATAGTGAGGAATATATGTTTC
                                      Chromosome:
                                      6:53495321
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      A=0.4173/2090
                                      HGVS:
                                      NC_000006.11:g.53360119G>A, NC_000006.12:g.53495321G>A

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center