Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 40

1.

rs13017599 [Homo sapiens]
    GTTGCCGTCGTTTTTGCATCTCTTG[A/G]TTGTTCAGCTTTTCCATCCTCCACA
    Chromosome:
    2:60937196
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1260/631
    HGVS:
    NC_000002.11:g.61164331G>A, NC_000002.12:g.60937196G>A, NG_009843.2:g.873C>T, XM_005264472.1:c.923-6998G>A
    2.

    rs12537284 [Homo sapiens]
      aaacaacttcaactcatacatttcc[A/G]gtaggaatggaaaatggtacagcct
      Chromosome:
      7:129077852
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0709/355
      HGVS:
      NC_000007.13:g.128717906G>A, NC_000007.14:g.129077852G>A
      3.

      rs10239340 [Homo sapiens]
        CCTAATTTTATGCCTTAAGGAGCCA[G/T]AAAAAGAACAAACTAAATCCAAAGC
        Chromosome:
        7:129028456
        Gene:
        TNPO3 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.4499/2253
        HGVS:
        NC_000007.13:g.128668510T>G, NC_000007.14:g.129028456T>G, NG_023428.1:g.31718A>C, NG_027864.1:g.59T>G, NM_001191028.2:c.121-10299A>C, NM_012470.3:c.121-10299A>C, NR_034053.2:n.685-10299A>C
        6.

        rs7775397 [Homo sapiens]
          CCTTTCAGTACAACTGACTCCCTCT[G/T]CTTTACCTGGGCTTCCTGTCCCTTT
          Chromosome:
          6:32293475
          Gene:
          C6orf10 (GeneView) LOC101929163 (GeneView) LOC105379657 (GeneView)
          Functional Consequence:
          downstream variant 500B,intron variant,missense,upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0194/97
          HGVS:
          NC_000006.11:g.32261252T>G, NC_000006.12:g.32293475T>G, NM_001286474.1:c.1192A>C, NM_001286475.1:c.1150A>C, NM_006781.4:c.1198A>C, NP_001273403.1:p.Lys398Gln, NP_001273404.1:p.Lys384Gln, NP_006772.3:p.Lys400Gln, NR_136244.1:n.440+30666T>G, NR_136244.1:n.440+30704T>G, NR_136245.1:n.242+38061T>G, NR_136246.1:n.242+38061T>G, NR_136246.1:n.242+38099T>G, NT_167245.2:g.3534914T>G, NT_167246.2:g.3598468T>G, NT_167249.2:g.3609749T>G, XM_005248809.1:c.1192A>C, XM_005248810.1:c.1171A>C, XM_005272765.1:c.1192C, XM_005272765.1:c.1192C>A, XM_005272766.1:c.1171C, XM_005272766.1:c.1171C>A, XM_005274911.1:c.1192A>C, XM_005274912.1:c.1171A>C, XM_005275077.1:c.1192A>C, XM_005275078.1:c.1171A>C, XM_005275341.1:c.1192A>C, XM_005275342.1:c.1171A>C, XM_005275508.1:c.1192A>C, XM_005275509.1:c.1171A>C, XM_017010182.1:c.916A>C, XM_017010183.1:c.*536A>C, XM_017010184.1:c.*536A>C, XM_017010185.1:c.1231A>C, XP_005248866.1:p.Lys398Gln, XP_005248867.1:p.Lys391Gln, XP_005272822.1:p.Gln398, XP_005272822.1:p.Gln398Lys, XP_005272823.1:p.Gln391, XP_005272823.1:p.Gln391Lys, XP_005274968.1:p.Lys398Gln, XP_005274969.1:p.Lys391Gln, XP_005275134.1:p.Lys398Gln, XP_005275135.1:p.Lys391Gln, XP_005275398.1:p.Lys398Gln, XP_005275399.1:p.Lys391Gln, XP_005275565.1:p.Lys398Gln, XP_005275566.1:p.Lys391Gln, XP_016865671.1:p.Lys306Gln, XP_016865674.1:p.Lys411Gln, XR_953050.1:n.-994A>C
          7.

          rs7750641 [Homo sapiens]
            CCTCCTGACCTTTGGCCCTGAAGGG[C/T]CCCCAGGAACCAGCCCCTCGGAGTT
            Chromosome:
            6:31161533
            Gene:
            TCF19 (GeneView)
            Functional Consequence:
            missense
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.0238/119
            HGVS:
            NC_000006.11:g.31129310C>T, NC_000006.12:g.31161533C>T, NM_001077511.1:c.325C>T, NM_001318908.1:c.325C>T, NM_007109.2:c.325C>T, NP_001070979.1:p.Pro109Ser, NP_001305837.1:p.Pro109Ser, NP_009040.2:p.Pro109Ser, NT_113891.3:g.2643956T, NT_113891.3:g.2643956T>C, NT_167245.2:g.2420848C>T, NT_167246.2:g.2472033C>T, NT_167247.2:g.2505647C>T, NT_167248.2:g.2419565C>T, NT_167249.2:g.2464948C>T, XM_005249334.1:c.325C>T, XM_005249335.1:c.325C>T, XM_005249336.1:c.325C>T, XM_005272865.1:c.325T, XM_005272865.1:c.325T>C, XM_005272866.1:c.325T, XM_005272866.1:c.325T>C, XM_005272867.1:c.325T, XM_005272867.1:c.325T>C, XM_005272868.1:c.325T, XM_005272868.1:c.325T>C, XM_005275018.1:c.325C>T, XM_005275019.1:c.325C>T, XM_005275020.1:c.325C>T, XM_005275155.1:c.325C>T, XM_005275156.1:c.325C>T, XM_005275157.1:c.325C>T, XM_005275287.1:c.325C>T, XM_005275288.1:c.325C>T, XM_005275289.1:c.325C>T, XM_005275449.1:c.325C>T, XM_005275450.1:c.325C>T, XM_005275451.1:c.325C>T, XM_005275588.1:c.325C>T, XM_005275589.1:c.325C>T, XP_005249391.1:p.Pro109Ser, XP_005249392.1:p.Pro109Ser, XP_005249393.1:p.Pro109Ser, XP_005272922.1:p.Ser109, XP_005272922.1:p.Ser109Pro, XP_005272923.1:p.Ser109, XP_005272923.1:p.Ser109Pro, XP_005272924.1:p.Ser109, XP_005272924.1:p.Ser109Pro, XP_005272925.1:p.Ser109, XP_005272925.1:p.Ser109Pro, XP_005275075.1:p.Pro109Ser, XP_005275076.1:p.Pro109Ser, XP_005275077.1:p.Pro109Ser, XP_005275212.1:p.Pro109Ser, XP_005275213.1:p.Pro109Ser, XP_005275214.1:p.Pro109Ser, XP_005275344.1:p.Pro109Ser, XP_005275345.1:p.Pro109Ser, XP_005275346.1:p.Pro109Ser, XP_005275506.1:p.Pro109Ser, XP_005275507.1:p.Pro109Ser, XP_005275508.1:p.Pro109Ser, XP_005275645.1:p.Pro109Ser, XP_005275646.1:p.Pro109Ser
            9.

            rs7111341 [Homo sapiens]
              GGACTAGGTAAAGTCCCCTGGGGAA[C/T]AATCTGTGACCCCTCCTCCCCGAGC
              Chromosome:
              11:2191936
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2386/1195
              HGVS:
              NC_000011.10:g.2191936C>T, NC_000011.9:g.2213166C>T
              10.

              rs6897932 [Homo sapiens]
                GGGGAGATGGATCCTATCTTACTAA[C/T]CATCAGCATTTTGAGTTTTTTCTCT
                Chromosome:
                5:35874473
                Gene:
                IL7R (GeneView)
                Functional Consequence:
                intron variant,missense
                Allele Origin:
                T(germline)/C(germline)
                Clinical significance:
                Benign
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.1725/864
                HGVS:
                NC_000005.10:g.35874473C>T, NC_000005.9:g.35874575C>T, NG_009567.1:g.22585C>T, NM_002185.2:c.731C>T, NM_002185.3:c.731C>T, NP_002176.2:p.Thr244Ile, NR_120485.1:n.641-1039C>T, XM_005248299.1:c.706+825C>T, XM_005248299.3:c.706+825C>T, XM_005248300.1:c.706+825C>T
                12.

                rs6439924 [Homo sapiens]
                  ACCAAGTAAAAATATTTAGAACTGA[A/C]TGTGAAATAAACTCTGCTTGATATT
                  Chromosome:
                  3:140450815
                  Gene:
                  CLSTN2 (GeneView) LOC105374132 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.1871/937
                  HGVS:
                  NC_000003.11:g.140169657A>C, NC_000003.12:g.140450815A>C, NM_022131.2:c.973+2111A>C, XM_017007022.1:c.898+2111A>C, XR_924548.2:n.1813-772T>G, XR_924549.2:n.1813-1039T>G
                  13.

                  rs6438101 [Homo sapiens]
                    TGCCAGGTCCTGGGCTGAACACGGT[A/G]CATAAACTCATTTAATATCTAAACT
                    Chromosome:
                    3:112734282
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.3938/1972
                    HGVS:
                    NC_000003.11:g.112453129G>A, NC_000003.12:g.112734282G>A
                    14.

                    rs4788084 [Homo sapiens]
                      GTTCTGTGGCCTTCAGGGAGTCCCA[A/G]GGGAGCAAGATTAGAGCACCCAGTC
                      Chromosome:
                      16:28528527
                      Gene:
                      IL27 (GeneView)
                      Functional Consequence:
                      upstream variant 2KB
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2997/1501
                      HGVS:
                      NC_000016.10:g.28528527C>T, NC_000016.9:g.28539848C>T, NM_001310136.1:c.121-61625G>A, XM_011545780.2:c.-2168G>A
                      15.

                      rs4613763 [Homo sapiens]
                        CTGATATAAGACAGGTTTATTCCCA[C/T]CACATTTCTTACCCCAGTAGACAGT
                        Chromosome:
                        5:40392626
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.0903/452
                        HGVS:
                        NC_000005.10:g.40392626T>C, NC_000005.9:g.40392728T>C
                        20.

                        rs3128982 [Homo sapiens]
                          AACCCAAGCAGAGAAAATCAGTCTC[A/G]TCGGCAAAGGAAACAGAGATCAGAG
                          Chromosome:
                          6:31449414
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          G=0.1122/562
                          HGVS:
                          NT_113891.2:g.2929824G, NT_113891.2:g.2929824G>A, NT_113891.3:g.2929718G, NT_113891.3:g.2929718G>A, NT_167246.1:g.2763069A>G, NT_167246.2:g.2757449A>G, NT_167249.1:g.2750933G, NT_167249.1:g.2750933G>A, NT_167249.2:g.2751635G, NT_167249.2:g.2751635G>A

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center