Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs13281615 [Homo sapiens]
    GTAACTATGAATCTCATCAAAAGAA[A/G]GCAGAACGCAGATATTCTGAGTAGG
    Chromosome:
    8:127343372
    Gene:
    CASC21 (GeneView) CASC8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    G=0.4912/2460
    HGVS:
    CM000670.2:g.127343372A>G, NC_000008.10:g.128355618A>G, NC_000008.11:g.127343372A>G, NR_117099.1:n.457+3937A>G, NR_117099.1:n.457+3938A>G, NR_117100.1:n.1177-53312T>C, NR_117100.1:n.1177-53313T>C
    2.

    rs6983269 [Homo sapiens]
      GGGCCATGGACACTCATATTTGGCT[A/C]AGAATAAATCTCTTCATGTATTTTA
      Chromosome:
      8:2741967
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4123/2065
      HGVS:
      CM000670.2:g.2741967C>A, NC_000008.10:g.2599496A>C, NT_187576.1:g.910033C>A
      3.

      rs6983267 [Homo sapiens]
        GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT
        Chromosome:
        8:127401060
        Gene:
        CASC8 (GeneView) CCAT2 (GeneView)
        Functional Consequence:
        intron variant,nc transcript variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3902/1954
        HGVS:
        CM000670.2:g.127401060G>T, NC_000008.10:g.128413305G>T, NC_000008.11:g.127401060G>T, NR_109834.1:n.662G>T, NR_117100.1:n.1176+19769C>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center