Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs2291667 [Homo sapiens]
    CTGGGACGAAGCCACCGGAGACAGT[C/T]GTGCAGTGTGGCCCGGGTGGGTCTG
    Chromosome:
    19:6669975
    Gene:
    TNFSF14 (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0016/8
    HGVS:
    NC_000019.10:g.6669975G>A, NC_000019.9:g.6669986G>A, NM_003807.4:c.95C>T, NM_172014.3:c.95C>T, NP_003798.2:p.Ser32Leu, NP_742011.2:p.Ser32Leu, XM_005259670.1:c.95C>T, XM_017027417.1:c.95C>T, XM_017027418.1:c.95C>T, XP_005259727.1:p.Ser32Leu, XP_016882906.1:p.Ser32Leu, XP_016882907.1:p.Ser32Leu, XR_001753777.1:n.621C>T, XR_936212.2:n.621C>T
    2.

    rs344560 [Homo sapiens]
      TGTGGTACACCTGGAGGCTGGGGAG[A/G]AGGTGGTCGTCCGTGTGCTGGATGA
      Chromosome:
      19:6665009
      Gene:
      TNFSF14 (GeneView)
      Functional Consequence:
      intron variant,missense
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.0403/202
      HGVS:
      NC_000019.10:g.6665009T>C, NC_000019.9:g.6665020T>C, NM_003807.4:c.640A>G, NM_172014.3:c.532A>G, NP_003798.2:p.Lys214Glu, NP_742011.2:p.Lys178Glu, XM_005259670.1:c.532A>G, XM_017027417.1:c.640A>G, XM_017027418.1:c.298+2104A>G, XP_005259727.1:p.Lys178Glu, XP_016882906.1:p.Lys214Glu, XR_001753777.1:n.824+2104A>G, XR_936212.2:n.824+2104A>G

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center