Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 10

1.

rs12334903 [Homo sapiens]
    TGACCTGGCTGCTTGTCCTTCTCTT[C/T]ATCCATCCAAATTTGCCCATGCGTG
    Chromosome:
    8:127038268
    Gene:
    LOC105375751 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    C=0.4191/2099
    HGVS:
    CM000670.2:g.127038268T>C, NC_000008.10:g.128050513T>C, NC_000008.11:g.127038268T>C, XR_001746076.1:n.1425-10970T>C
    2.

    rs11988857 [Homo sapiens]
      aaaatcaattgtatttgaatgtatc[A/G]acagtaaacatatggacattaaaat
      Chromosome:
      8:127519628
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2360/1182
      HGVS:
      CM000670.2:g.127519628G>A, NC_000008.10:g.128531873G>A
      3.

      rs11986220 [Homo sapiens]
        agccagtgcaattaagaggaaaaaa[A/G/T]taaataaaaaggcatatgtgttgaa
        Chromosome:
        8:127519444
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0990/496
        HGVS:
        CM000670.2:g.127519444A>G, CM000670.2:g.127519444A>T, NC_000008.10:g.128531689A>T
        4.

        rs7017300 [Homo sapiens]
          AGTTTCCCTTTGTATGATGCCTAGA[A/C]CCAGCAACAGGGCAGTTGCAGTGAT
          Chromosome:
          8:127513023
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2200/1102
          HGVS:
          CM000670.2:g.127513023C>A, NC_000008.10:g.128525268C>A
          5.

          rs6983267 [Homo sapiens]
            GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT
            Chromosome:
            8:127401060
            Gene:
            CASC8 (GeneView) CCAT2 (GeneView)
            Functional Consequence:
            intron variant,nc transcript variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.3902/1954
            HGVS:
            CM000670.2:g.127401060G>T, NC_000008.10:g.128413305G>T, NC_000008.11:g.127401060G>T, NR_109834.1:n.662G>T, NR_117100.1:n.1176+19769C>A
            6.

            rs4242384 [Homo sapiens]
              AGTCCCATGCTAGAAGCTGCTTTAC[A/C]AACACAGTCAGCTGCTATCTCCACA
              Chromosome:
              8:127506309
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.1264/633
              HGVS:
              CM000670.2:g.127506309C>A, NC_000008.10:g.128518554C>A
              7.

              rs4242382 [Homo sapiens]
                ATTTTGTCCCTCTAGTTATCTTCCC[A/G/T]CAGGCCCATCAAGAATCAGGCAGTA
                Chromosome:
                8:127505328
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                A=0.1873/938
                HGVS:
                CM000670.2:g.127505328A>G, CM000670.2:g.127505328A>T, NC_000008.10:g.128517573A>G
                8.

                rs1456310 [Homo sapiens]
                  CACAGTGAGAAAAAGGAGTAGATGA[A/C/T]GAGAGAGCAAACTCACAAAATTGCT
                  Chromosome:
                  8:127040188
                  Gene:
                  LOC105375751 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                  Global MAF:
                  G=0.4860/2434
                  HGVS:
                  CM000670.2:g.127040188A>G, CM000670.2:g.127040188A>T, NC_000008.10:g.128052433A>G, NC_000008.11:g.127040188A>G, NC_000008.11:g.127040188A>T, XR_001746076.1:n.1425-9050A>G, XR_001746076.1:n.1425-9050A>T
                  9.

                  rs1447295 [Homo sapiens]
                    AGTGCCATTGGGGAGGTATGTAAAA[A/C/T]GTGCTATGGAAAAAAAGCAACAGGA
                    Chromosome:
                    8:127472793
                    Gene:
                    CASC8 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1811/907
                    HGVS:
                    CM000670.2:g.127472793A>C, CM000670.2:g.127472793A>T, NC_000008.10:g.128485038A>C, NC_000008.11:g.127472793A>C, NC_000008.11:g.127472793A>T, NR_024393.1:n.1041+6290T>A, NR_024393.1:n.1041+6290T>G, NR_117100.1:n.1041+6290T>A, NR_117100.1:n.1041+6290T>G
                    10.

                    rs980171 [Homo sapiens]
                      AGGAACATTCATTTGATTTCTCATT[C/T]ACTGGAGTATCCTGGTGACTTTAAT
                      Chromosome:
                      8:127042277
                      Gene:
                      LOC105375751 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.4279/2143
                      HGVS:
                      CM000670.2:g.127042277A>G, NC_000008.10:g.128054522A>G, NC_000008.11:g.127042277A>G, XR_001746076.1:n.1425-6961A>G

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center